Busch Lab

ZMP

ENSDARG00000089075

Ensembl ID:
ENSDARG00000089075

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13286
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122579 Nonsense 143 918 5 17
Genomic Location (Zv9):
Chromosome 24 (position 34636827)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33488457
GRCz11 24 33402867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAATTAGATTTTTNAATAAATATTTTAATCAGGAGCGTGAGTTGGTGT[T/A]GAAGAGGATAGCAGAGGAYCGACGCAGTCAGCAGGAGAAGGCCCAAACTG
Associated Phenotype:
Not determined