Busch Lab

ZMP

AZI1 (2 of 2)

Ensembl ID:
ENSDARG00000088984
Description:
5-azacytidine induced 1 [Source:HGNC Symbol;Acc:29511]
Human Orthologue:
AZI1
Human Description:
5-azacytidine induced 1 [Source:HGNC Symbol;Acc:29511]
Mouse Orthologue:
Azi1
Mouse Description:
5-azacytidine induced gene 1 Gene [Source:MGI Symbol;Acc:MGI:107440]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44773 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44773
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085662 Nonsense 604 778 15 19
ENSDART00000129888 Nonsense 601 1102 14 25
Genomic Location (Zv9):
Chromosome 12 (position 37794385)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 36171499
GRCz11 12 35865754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACTAACTGTCAGAGACTAATGTAAAGGTAAATGTGTGTCTTTAGGCC[C/T]AGCAGAGGGAGCTGACGATCCGACACGTGAAGGAGACAGAGAAAGAGCTT
Long Flanking Sequence:
AGGATTTAGGCTGTACTGTGTGTATGTAGGTTTTTTCAGTGAAAATAAAAATAAAGAGTAAAAACACAATTGAACAACTATATATATTAGTTATAAGTTCTTTCTTAACTTCAAGCAATGTGTTCTTTGATTTCAGTTTGAAGTATTTATCAAATAATCATAAATAGTTGGTTTCCTTCAATTATTTTAGTATGAGTATGATTAGAAATGAGCATACTTATGTATTAATGTTCTCAGTCTAATGTTTTTATTTGTAAAGGGTTCATATTTACTGTACAAACTTCCAATGAACTATGAGAAAGGGAAAATTTTTATAAAAATTCAATTGAAAATAAAATAATTGTTCAAAAATTATTTCGAGGTAGTGTTCAATTTATCAAGGTTTTGCTTTTGGGTCATATTGCCCAGCCCTAGTTTATACCTTCAACCTCATTCGATGTTTAGATGTGGAAAACTAACTGTCAGAGACTAATGTAAAGGTAAATGTGTGTCTTTAGGCC[C/T]AGCAGAGGGAGCTGACGATCCGACACGTGAAGGAGACAGAGAAAGAGCTTAATCATACTTTTCAGCTACAGAAAGAGCAGTATGAAGCGACAATACAGAGACACCTGACATTTATAGACCAGGTATTAATCTCAACACATCACACCTGCATAGAGACACCAGACATTTAAAGACTGGGTATTAATCTTGATACAGCATCTATTCAGTTTGACAAAGCTTTGTCTGAAATATGTCTTGACATTAAGTTTAATGACTAAACTATAGTCAAATATCGATGAGGATTAAAACAAATGTATTTGGTCGCATTACAGTAAAAATAATCTGATCGCAAGACATTAATTGAACATAATGCCTTTATGTGAAAAAATAAATACAAAAGGAAAGAAAGACATTAGTATTGTAATTTGATGAACATATCAAAAACAGTTACATTACACCAGCCTTTCTCAATGCTGGTTCCTTAACACTCCTTTCTTGGAGCTCTTTTCTAATTAGCTGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27998
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085662 None None 778 None 19
ENSDART00000129888 Nonsense 889 1102 21 25
Genomic Location (Zv9):
Chromosome 12 (position 37812533)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 36153351
GRCz11 12 35847606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGATCTCATCCTTGCATTTCATCCCACAGGAAGCATGGCTGTTGAGT[C/T]GAGAGAGGGAGCTGAAAGAGGAAGTGCGTCGTGGAAGAGACAAAGAGATC
Long Flanking Sequence:
GAAATTCTAACATTCTAAAAGCTATAATAAATAATCTGATATGTGTTTTTAGCTGAAACTTTACAGACACATTGTGGAGACACAAAAGACTTAGATTAAATCTTGAAAAGGGGTAAAAAAAAAAAAGGTGACCTACGTGTCATTCAACCTCTTATGAGATTATAAACAAGGAAAAAACCAAACATTTGAACAGTAGTGTGTTGTTCAATTGAACTAGCCATAGTCATTATTTTGTAACAAGTCCAAATGACCTCCATTATTGGATAACATCTAACCTAATCTAATTAGCTGTTGCACAGGTTGACTGGTAATAAGTCATCTTTAAAGGTGACAGCGGAGTGATTTGCTGTTTTGCCGGTTTAGTGTGTTAGTCCACCCCAGAGGTCAAAATAGTCACACATCTGTCAAACAAAGGCCATTAACAAATTCAGTGAAGGTAACAAAGTTAAAAAGTGATCTCATCCTTGCATTTCATCCCACAGGAAGCATGGCTGTTGAGT[C/T]GAGAGAGGGAGCTGAAAGAGGAAGTGCGTCGTGGAAGAGACAAAGAGATCGAACTGGCCATTCAGAGGCTAGAGGTGGAGACCAGAGAGGCCAGAGAGGAGTGCGAGCGAGCTGCTGACAACCGGTGGGTTCTTCTTCCTGTTTATGTGTGAACAAGTGTGTCCGTGGAGAGATAGACAGCACAGGATGTTACAGATTGCCCACATGCATTTCAAGGCCAGTGCGAGTAAATGTGTGCAGGCGTTTAATTAAGACCAAAGACACTGTGCATTTGATTTCCCCACTGACTCATTTAATTTAGTTTAGCTTAAATGTTGACCATAAAAAACAACATGAAAAAATACTGTAATAAAATACAATAGAATTGAACTAATAATACGTAAAACATAAAAGGCATGGATATGTGTTTAATAAAAATATAAATATATATTTGAAGGTTATTTGTTTTTATTTAGATTAAAATGATGCCAATTTTAAAGCTCTAAATAATGCAGTCCAGT
Associated Phenotype:
Not determined