Busch Lab

ZMP

si:ch211-14k19.7

Ensembl ID:
ENSDARG00000088975
ZFIN ID:
ZDB-GENE-090313-42

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125596 Nonsense 985 1203 7 11
ENSDART00000147833 None None 181 None 5
Genomic Location (Zv9):
Chromosome 1 (position 8181019)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8420824
GRCz11 1 9104935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTGAATACTGTAAACATCAGGGCATCTGYGTTCACCGCCTCGGGCAG[C/T]AGCCTATCTGCCAGTAAGTTATATAGCATAACAGATTTTTGACTTGYGGC
Long Flanking Sequence:
AAAGCATTAAAACATTTTGTATTTCATTTCATTTTCTCACTATCACCGTACCACTATCAATGAGACAGTCCACCCAAATATGAGAAATTTGAAATCATTTACTCTCCCTTCACTTTTTCCAAACACAAAGTAAGATAGACTAAAGAATGCTGAAAAAAGGCATTGACTTCCACAGTATTTCTGTTCCTAAAAACGAATGTCGATGGCTGCATTTTTCAGATTTTGATCTTATTTTGTGTTCAATAGAAGAAAAAAATCATGATAGTTTACAACTACTTATGTATGTGTGTGAGTAAATTTTAATGTTTGCATAAACCATCCCTTTAGGTACCAACTTCTTTCTCTCTCTTTCAGGTTTGCAGACAGATGCTTGTGAATGGTTGCTTGAATGTCCGTCTGGGTTCCAGTGTGTCTCCTCCAAGGGAAATGCCACCTGTACATCTGTGTGCCACTCTGAATACTGTAAACATCAGGGCATCTGTGTTCACCGCCTCGGGCAG[C/T]AGCCTATCTGCCAGTAAGTTATATAGCATAACAGATTTTTGACTTGCGGCATAAAGCCTGGTCTATGTTAATCAGGAACTGCCCAGTCAAACAAGAAGAAACCATCTGACCAATATGCACAGCTTGTAAACAGCACTGATTAAAGTCCTGCTGAAATAACCAGGCTGTCTCTTTCTGAAGGTGTCCCGTCGGGGAGGATTACTGGTTTATGGGCCAGCGATGTGACCTCCGCATGACCCGGCCGCGTCTGGTTGGCGTATGTTTTGGGGTACTAGTTGCTGTCGCAGCAGTCATGGCTCTTCTGTCATATCTCGCTGTGCGCCGGTTTAAAAGCATGCTAATGCAAGCCAAAGCGGAGCAAACACGCAGCAGGTATGACATGTGCAATCATTTCAATGGAACATTTTACAACTCTCCTAGACTTTAACAGTTGAGTTTTACCATCTTTGAATCCATTCAGCCAATCACCAGGTCTGGTGGGAGCTTTAGCTTAGCATAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25524
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125596 Nonsense 1068 1203 9 11
ENSDART00000147833 None None 181 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8179577)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8419382
GRCz11 1 9103493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTTATCGCAGATTTAATCACTTTGATGAGCTTTCGGCTCGTTTTTG[G/A]GGAAGGTCCTGGCCTGGCTCTGAGGACTCTCTGGATAACCCTGGCTTCAC
Long Flanking Sequence:
ACTAGGCTTTCTAGAAACATCTTTGCAGGTGTGTTGAGGCAAGTTGGAGCTCAAATCTGCAGGACACCGGCCCTCCAGGACTGAGTTTGGACATCCCTGGTCTAATCCAATTAATGATTAATGCGAAGCTAAGCTAAAAGTGTTCCTGGAAGTTTCTGTGATGGACTGAACAGATTAAAAATGGCCAACTGTTTACATCTAGTAGAGTTGTAAAATGAGCTTATTTTTTAAAAAAGTGGAATGTTCCTTTAAACACACACGCACACACAAATCTGTCTGTTTTTGTTATTGGAAACAGTTTGCAGGAAGCCATCACACTATGGGTTTGTGATAGCACCACTTAAAGGGAGGGAATGGGTTGTGTGATCACACACAGACACACTACTGTAAATTAATTTTACTAACAATCCATTGTGTTCTGTGTGTGTGTCTTCTGTGTGTGTGTGTGGACACAGTTATCGCAGATTTAATCACTTTGATGAGCTTTCGGCTCGTTTTTG[G/A]GGAAGGTCCTGGCCTGGCTCTGAGGACTCTCTGGATAACCCTGGCTTCACCCGCTCAGATGAACTGCTTCACCTGAGGGCTCTCGACCGCACCTGCTGTTACCATGACGACACTCTATCAGTGGTGTCCACATACCATGGTAGCGGAGCACACCTCAACACTGTATATCCTCATGGGTACAGTATGATTTATGGGATATTATCAAATGAACAATGGTGCTTGCCGTTTGTTTTACACTGTTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGCAGAATGAACCGCCAACTTATCCAGCAAGTTTTTACTCAGCGGATGCCCTTCCAGCTGCAACCCATCTCTGGGAAACATCCACACACACATTCACACACACTCATACACTACGGACAATTTAGCCTACCCAATTCACCTGAACCGCATGTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGCGAACGCAGG
Associated Phenotype:
Not determined