Busch Lab

ZMP

zgc:158458

Ensembl ID:
ENSDARG00000088905
ZFIN ID:
ZDB-GENE-070112-622
Description:
high affinity cAMP-specific and IBMX-insensitive 3',5'-cyclic phosphodiesterase 8A [Source:RefSeq p
Human Orthologue:
PDE8A
Human Description:
phosphodiesterase 8A [Source:HGNC Symbol;Acc:8793]
Mouse Orthologue:
Pde8a
Mouse Description:
phosphodiesterase 8A Gene [Source:MGI Symbol;Acc:MGI:1277116]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa39507 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39507
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127815 Nonsense 266 326 6 7
Genomic Location (Zv9):
Chromosome Zv9_NA18 (position 2432)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17497
GRCz11 18 17497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTACAACGACACGGCGGTGCTGGAGAGTCACCACGCCGCGCTCGCCTTC[C/T]AGATCACCACACGAGACGACAAGAGCAACATCTTCAGGAACATGGAGAGG
Associated Phenotype:
Not determined