Busch Lab

ZMP

si:dkey-1b17.11

Ensembl ID:
ENSDARG00000088903
ZFIN ID:
ZDB-GENE-050208-786
Description:
Si:dkey-1b17.11 protein [Source:UniProtKB/TrEMBL;Acc:A8KBJ0]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13519 Nonsense Available for shipment Available now
sa3184 Nonsense F2 line generated Not yet available
sa37410 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 26 267 3 3
ENSDART00000132151 Nonsense 62 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2926982)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1739830
GRCz11 22 1756728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAATGTTACTCATTTACTTCATTTTCAGATGTGATGGTGAAGGAGGAA[G/T]RACTGAGWGAAGAWGAGGAGAAACATCATGTCAAGAGTGAAGATGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3184
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 112 267 3 3
ENSDART00000132151 Nonsense 148 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2927240)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1740088
GRCz11 22 1756986
KASP Assay ID:
554-3148.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGCTTCAATCGTTTAGGAACCCTAAAAACACACATGCTGCTCCACACC[G/T]GAGAGAAAACACACACATGTGAGCAATGCGGCAAGTCATTTTTGAGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37410
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106493 Nonsense 189 267 3 3
ENSDART00000132151 Nonsense 225 303 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2927471)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1740319
GRCz11 22 1757217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGCTGTGAGTGCGAGAAGACTTTTATTACAGCGGTAGACTTGAGA[C/T]GACACCAGAGGAGTCACACTGAGGAGAAACCGTACAAGTGTTTACACTGC
Associated Phenotype:
Not determined