Busch Lab

ZMP

smarcd2

Ensembl ID:
ENSDARG00000088877
ZFIN ID:
ZDB-GENE-080215-1
Human Orthologue:
SMARCD2
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 [S
Mouse Orthologue:
Smarcd2
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 Ge

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13736 Essential Splice Site Available for shipment Available now
sa45453 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13736
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127343 Essential Splice Site 171 501 4 13
Genomic Location (Zv9):
Chromosome 12 (position 11219366)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10102437
GRCz11 12 10140280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCGCAAACGCATGGARATACAGGAGGCCATCAAAAAGCCCATCACGG[T/C]AGATGTWATCAATTGRAGTAGAAATACAGACGTGACTTTTGATTTTGTTT
Long Flanking Sequence:
CAGTGTTTTTGCTCAGTCATTCTTTAAGGAAATATCCATAATTTTGTAAATGTTTATTAAATATATTAATAGTTTAATTTTAAGTCTTGTGAGGAAGGATTTGTTGGGAATTGGTTGGATAGGATTGTTTAAGATTAACTGTTGCGTACAGTTAAGGTCTCCAGCACTCAGTAATTGAAATAATATTTGAACATATGTCCGTGTTGAGTCATGTTTTTACACATCTGCTCCACATTTTCAGAGTGAAGAGGCGTAAGATGGCTGACAAAGTCCTCCCACAGAGGGTGAGTTTAGCCAGAGTAGCATAAATCAGTTTTTTGTGTGTGTGTGTGTGTTCCTTAAGTGCATAGTTTCTCATGGTTTCGCTGTTCTCCAGATCAGGGATTTGGTCCCAGAGTCTCAGGCATACATGGACCTTCTGGCCTTTGAAAGAAAACTGGACCAGACCATTGCTCGCAAACGCATGGAGATACAGGAGGCCATCAAAAAGCCCATCACGG[T/C]AGATGTTATCAATTGGAGTAGAAATACAGACGTGACTTTTGATTTTGTTTATGTTAAAGTGATAGGTCATTGTATACTTTACCATTTTTAATTTCTCTCTCTCTCTCTCTCTGTGCAATAAAAACAAATATTAACTGGATGTTGGTAACCAAACAGAAACATAAACAGCTTTACAAAGACCTGAGGTTGAGTAAATGATGAGAGAGTTTACCTTTCTCTTTGGAGCAACATCAAGAAACTAACCAATTTGTTTAACCCATTCATTAACTAACCTAGTCTACGGTGACCTAGGCTCCATTTACACTGCATGGTTCAAGTGACTCAATTCGGATTTTTTTTTCTTCCATGTGGCGTCAGATATGGCGCATGTACATGTAAGCAGGAAAAAATCACATGGATTCCGATTTACTCAAATCAGATTTAGGCCTTGTTCAAATGTGGAAATGTATCCAGTACGAATCGGATCTGTGTCCTTGTGTCTGCAGTAGGGATGGGTACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27899
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127343 Nonsense 327 501 8 13
Genomic Location (Zv9):
Chromosome 12 (position 11230361)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10113432
GRCz11 12 10151275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACAACAAGCTGCAAGATTGCCACGAGAAAGAGTACATTAACTGCAAC[C/T]GATACTTTAGACAGGTATGCAAAAAGTTGGTTGGTTTTAAACGTTTTTTA
Long Flanking Sequence:
AGAGACCAGGAGATGTGAATGTGAAATGCACTCTGCTTCTCATGCTGGACCACCAGGTATTACATGCACATCCTTTATGATACATGCTTTTATATTATTTGATTATTTTCAGCTGCCTTTAGCTTAAGAAATATAATTATTTTATTTAATTATTGCTTTTGTAATGTAGTATAATCATTACATAAATGATTTTGAGAACAAAATGCTAATAAAAATAGTATACCTCTAGGAAAATATATCTCTAGAAATGTAAATACCACCGCAATACTATTGGTTTTGTTTGTTCCAGAGCATAGTATTGGATGTTTTTAATAATATTATGAACTTTTGTTTTCTCCTTTTACTTGATTAAGCCTCCACAGTACAAGCTGGACCCACGTCTGGCTCGACTGCTGGGTGTCCACACTCAGACCAGAGCCAGTATCATGCAGGCCCTGTGGCTCTACATCAAGAACAACAAGCTGCAAGATTGCCACGAGAAAGAGTACATTAACTGCAAC[C/T]GATACTTTAGACAGGTATGCAAAAAGTTGGTTGGTTTTAAACGTTTTTTAACCCATTTTATTTATAAGTAAATAATGTCTTAAAGGTGCCATAAAATGTATTTATTCAATGTTAAATTGTGCATTTAAACAATATGTTAAATTGAAAGCCAAATAATTTTACTTCAGTTGTCAAAAAAATATTTTGATAAAATGGAGATGCCCTGTTAAATGGCAGTCTTTTCAACTGAAATGCTTGATATGTGGTATATTTTAGCTGTCTTTATGCCAAACAATTTTAAAAAATATCAATTTACATTTTCAAGCATTATTTTTTTGTATTAATTTATTTATAATTTATAATTTATTTATTTTTTGGATGAAATCTAGGCTAAATTGTAATTACACTTGAGAAAATGGGCTGGCAGAGATGTATTTAGTTTAATTTTGTGAGTTTAACGAAATGTTAACTATGAAAACAGACATGCTTGAATATTAACCTTTGCATAAACTTATAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45453
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127343 Nonsense 499 501 13 13
Genomic Location (Zv9):
Chromosome 12 (position 11238615)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10121686
GRCz11 12 10159529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTCAGGTCCAGCAGAGGAGACAGGAGTTGGAGCAGGTACTTGGAATC[C/T]GACTCACTTAAGAAGATTCAGACTCCAAATCCACAATCATCCGAGCAACT
Long Flanking Sequence:
CTACTCTAATATTACCGACTCTATAGTACTGACTCTAATAGTACCGACTCTAATAGTACCAACTGTAATATTACAGAATCCAGTAGTACCAACTTTAATTGTACTGACTCTAATAGTTCCGACTCTAATATTACAGACTCTAGTAGTACTGACTCTAATTGTACCAACTCTAATAGTACCTACTCTAATATTACCGACTCTATAGTACTGACTCTAATAGTACCGACTCTAATAGTACCAACTGTAATATTACAGAATCCAGTAGTACCAACTCTAATAGTACTGACTCTAATAGTTCCGACTCTAATATTACAGACTCTAGTAGTACTGACTCTAATTGTACCAACTCTAATAGTACCTACTCTAATATTACCGACTCTAATATTACCAACTCTAATAGTACCGACTCTAATAGAACTTCCCATAGTAAGCGCTCACCTTTTTTCACTTGATTTCAGGTCCAGCAGAGGAGACAGGAGTTGGAGCAGGTACTTGGAATC[C/T]GACTCACTTAAGAAGATTCAGACTCCAAATCCACAATCATCCGAGCAACTGATTCAACAAATGTTGAATCAGTTTCTGTTTCATAACCAGCGGATGCACTTCATGTGGGTTTTTGGTACTGGTCATAAACAGCTTGTCAGGTGCAGCATTTGCAGTACCATTACACACATCTGGCCAAATATATTTCAAGCGCTGTTACAATAACTGGAATGCCTCAGTTGCTATCTTCCCTTCTCTGGTCTTTATTTCTATATTGTGAAAAGAAAATATGAAAATAAGCCATTGAGTTCATGGCCTTTATTTGACATACACTCATACACAATAATACTCTTGTAATTTTTTTACAGTACAATGCAGTACTGTAGTTTGTTTGTTAAAACCCCATTGGAAATAGATAACAATCTTGATTTTGTGTTTTTAGTAGGAATTGCTGAAGTCAATTTGCCATTTTGTTTCTGATTCTTACAGCAAAGGATATTCCAACAAAATTAATTGCACAC
Associated Phenotype:
Not determined