Busch Lab

ZMP

STXBP6 (1 of 2)

Ensembl ID:
ENSDARG00000088862
Description:
syntaxin binding protein 6 (amisyn) [Source:HGNC Symbol;Acc:19666]
Human Orthologue:
STXBP6
Human Description:
syntaxin binding protein 6 (amisyn) [Source:HGNC Symbol;Acc:19666]
Mouse Orthologue:
Stxbp6
Mouse Description:
syntaxin binding protein 6 (amisyn) Gene [Source:MGI Symbol;Acc:MGI:2384963]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa8578 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8578
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125787 Nonsense 41 210 1 8
Genomic Location (Zv9):
Chromosome 17 (position 51347279)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50733881
GRCz11 17 50819322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTSAAGAGGAGGACCAAGAAGAAGATCCCGTTTCTGGCTACAGGAGGT[C/T]AGGGGGAATACACCACCTTCATCTGCTTATCAGGTGACACTCACAGCAAC
Associated Phenotype:
Not determined