Busch Lab

ZMP

ENSDARG00000088821

Ensembl ID:
ENSDARG00000088821

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa30335 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30335
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124078 Nonsense 27 434 1 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3465 (position 495673)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 71692641
GRCz11 4 73347169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGAGGATCACAGAAGTGTTCACACTGAAACAAGAAGATCACGAGGAA[C/T]AAACAGGTGGGTTTTCAGAGAGATTATCGTAAATGTAATGAATTTAAACA
Long Flanking Sequence:
AAAATTGTTTGGGTTCGAATCGGGTAAAACGACTCGGAAAACGCTGACGATAAATGCCATCGAAAAGCATCCTGGTGTGTACGAACTTTTAGGCTGTAATAACTCCCCAAACCCTTTTCCCTAACTTTCTGAATGAAATGGTTACTTTACTGCATCCAATCAGCTCGCTGTAGTAAAAACAAGCCACGCCCACTGTTTTCTCAGTTATTAATATTCCGTTTCTCTTGAAACTGCGTCACAATACAAGAAAAAAATAACAGCAGCTTCTAACTCTTTAATGTCTTTTGCAACATGGCTTAGTGTGTACATTTGTAGAGCTAGTTTTTAATGTTGTTGTTTTTTCTCCTAACAGGTAATTTAAAGCCGTAAATGACTGACTCCCTCGCATCGCCAGGAGCTGTTTGAGCTGAAAAAACTTAAAGATGGCGTTTATTAAACAGGAGAGTGAAGATCTGAGGATCACAGAAGTGTTCACACTGAAACAAGAAGATCACGAGGAA[C/T]AAACAGGTGGGTTTTCAGAGAGATTATCGTAAATGTAATGAATTTAAACACAAGGCAGAAATAAACAGTGGTAAAAGGCAACTATCAGTGCACATCAGTCTTCTGAGTTTATTCATTGTTTCAACACCTTAATGTTAGTCTAGGGCAGGGGTGTCAAACTCAGTTCCTGAAGGGCCACAGCCCTGCACAGTTTAGCTCTCTGCTTCAACACACTTACCTTGAGGTTTCAAACAAGCCTGACGAACTCAATTAGTTTAATATGGTGTGTTTAATTAGGGTTGGAACTAAACTGATAACATTTAAGGTGTGGCACTTTTACCATGTGATGGTAAAGCTAAAGCGAGCGTGCCAGGGCCAGTCGCATTTCCACTGTCTCTCCCAGGGCCTGATCGGGTCAAAGTGGTGTGTCCTCAGGGCCAGCGGCCGGCCTCTTTTGGCCCGCCAAATACTTTGAGGCAAAGAGGGCCAGCTGGGGCTTTGGGGCGGAGTGAAAGGAGAGG
Associated Phenotype:
Not determined