Busch Lab

ZMP

klhl22

Ensembl ID:
ENSDARG00000088807
ZFIN ID:
ZDB-GENE-081104-154
Description:
Novel protein similar to H.sapiens KLHL22, kelch-like 22 (Drosophila) (KLHL22) [Source:UniProtKB/TrE
Human Orthologue:
KLHL22
Human Description:
kelch-like 22 (Drosophila) [Source:HGNC Symbol;Acc:25888]
Mouse Orthologue:
Klhl22
Mouse Description:
kelch-like 22 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1337995]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34511 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34511
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129372 Essential Splice Site 74 625 None 6
ENSDART00000140567 Essential Splice Site 74 625 None 7
Genomic Location (Zv9):
Chromosome 8 (position 53989059)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51724418
GRCz11 8 51710947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATCCAGGCTCACCGAATTCTCCTGGCGGCGTCGTGTGACTATTTCAGG[T/C]ATGCATGACAGTCCTTACATGTTAGGAATGCTGAGACTATTATGTTTACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27285
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129372 Nonsense 239 625 3 6
ENSDART00000140567 Nonsense 239 625 3 7
Genomic Location (Zv9):
Chromosome 8 (position 53994412)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51729771
GRCz11 8 51716300
KASP Assay ID:
2260-1218.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGTATATTTATGAATGTTGTTGTACTTCAGGAACCGCTGCGGATGT[T/A]GGAGGCGGTGCGGTTCTGTCTGATGGAGAAGCACGTTTTGCAGCGTTTGC
Associated Phenotype:
Not determined