Busch Lab

ZMP

ENG

Ensembl ID:
ENSDARG00000088795
Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Human Orthologue:
ENG
Human Description:
endoglin [Source:HGNC Symbol;Acc:3349]
Mouse Orthologues:
Eng, Gm14378
Mouse Descriptions:
endoglin Gene [Source:MGI Symbol;Acc:MGI:95392]
predicted gene 14378 Gene [Source:MGI Symbol;Acc:MGI:3833469]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25986 Nonsense Mutation detected in F1 DNA Not yet available
sa19936 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38368 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Nonsense 139 861 4 18
Genomic Location (Zv9):
Chromosome 3 (position 6305608)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5833894
GRCz11 3 5743815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGTTCATTGTGTGTTCCAGTTGTCTGTGAACTCCACGGCAGAGTCTT[C/A]GAGTCTGTCTGTCCGCGTAACGCAGGTCCCATCTCTGCCGCGGCGGCCTC
Long Flanking Sequence:
GTGCTCAGCTCTCAGCAGGCCGTGCGTTGGGTTTTGGAAAATGAGGGACTGTCAAGCAACATCAATGTGCTGGTGCAGGTGTGTGTGATGTTACAGATGTTTTTTAGCTCTTTCCAGTGTGCAGGTGATCATTGTGTGACATTATTTTTGAAAACAAGACTATTTTTCTACGTGTCTAGAATTTTTAGATAGACTATAAATAAGACATAAGACATAAGTAAAAAAAAACTCTACAGACATATTTGTGATGAGACTTTTTTTCATGTATAATATTTATTTTACAGGTTACCCAAATTTTACTTACAGATTTTAGATCAATATACTTACCTAAAAGGAATGTCAGGAGAACATTGTGTTTGTTGGATACTTAGATGTTTAACAAGCAATTGCAGTGGCCACGTTTTCACTTTTTCATAAAATTGAGGGATTTCTGAGAAAAACATTTATTTCAGTTGTTCATTGTGTGTTCCAGTTGTCTGTGAACTCCACGGCAGAGTCTT[C/A]GAGTCTGTCTGTCCGCGTAACGCAGGTCCCATCTCTGCCGCGGCGGCCTCGAGTGCTGCTGCGCTGGGTTCTGCAGCGCCACGCCACCGTCACCTCCCTCACACACACCACACACTCCAACCGGATTTACTTGCGCCTGGGAGAGGGTGAGACACACACACTCACACATGCATACACAAACCTGAAGAACAGCTTTTCTGATCACACTCATTCTAATGTCACTACTGATTCATTTCAAATCAGTTTCTAATGTCAGTCCTGATTCACTCCTGATCACACTCATTCTAATGTCACTCCTGATTAATTTCGGATCACACTCATGCTAATATCGCTCTTGATTCATTTCTGATTGCACTGTTTTTAATGTCACTCCTGATTTACTCCTGATCACACTCATCCTAACATCACTCCTGATTCACACCGGATCACACTCATCCTAATCTCACTCCTGATTCATTTCTGATCACACTTATCTTGATGTCACTCCTAATTCATTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19936
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Essential Splice Site 398 861 8 18
Genomic Location (Zv9):
Chromosome 3 (position 6297289)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5825575
GRCz11 3 5735496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGAAGGCGGAGCTCTGACTGTTACCGTGGATATGCAGATGCTAAAGG[T/C]AGCAGACACACACACTGTATGATCCAGTGAACTAAAAATAAATGTTACAC
Long Flanking Sequence:
TTTCTCGAAACATTTCAATTTTATTCTCATAACATTTCGACTTTATTCTTGTAACATTTCAACTTTATTTTTTTAACATTTCGACTTTATTCTTTTAACATTTCGACATTTTTCTCTTAACATTTCAACTATTTTCTCATAACATTACAACATTATTCTCGTAACATTTCAACTTTTTTCCCGTAACATTTTGACTGTTCTTTTAACATTTCAACTTTTTCAGTTTTATTCTCATAACATTTCGACTTTTTTGTTCTCTTTACTCTCGTTACATTTAAAATTTTCTCAAAACATTTGACCTTATATTCTTAACATAGAAAAGAGTGTGTTGTTCACTAGTGTGTGTCTATAACGATGTGTTTTGTGATCTTCAGACTCTGATGATGCGTCTTCAGTCTGGCATCATCACGATGACATCACGATTGACAGTGCTGATGCGCTCAGCTATCAGTGTGAAGGCGGAGCTCTGACTGTTACCGTGGATATGCAGATGCTAAAGG[T/C]AGCAGACACACACACTGTATGATCCAGTGAACTAAAAATAAATGTTACACAAATATAAGTGTTGTAAGAAAAATGTGCAAGTGGGACGTGAAGGAAGAACAAGGAAGGGAACTGGCAAAAATCATAATAAAATAAATAATAATAATGCATATAATTATAATATCTGACCTATAATAATAATGCCAAACTGTTTGACCTGTCTGCAGACACAGGTTTGGCCAGTGACGGCGGTGACCCTGCAAGATCCAGAGTGTAAAGCTGAATTTAACGGAAGTCATTTCCTGTTGGTTTCCCCCATCATTTCCTGTGGTACCGAGGGAGAAATGGATGAAGCCAGTGGAAGGGTTCATTACACAAACACAGTGAGAGTAAAACATGATTAAACACATGCTGTATCTGCTAAAGCATCACACTTGTTTCTCAAGACGATTTGTGTTGCTTGTGTGATTTAAAAAATAGTGGCTCAGGTTTTGCTCTAAAATAAAATGTATTTATATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38368
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Nonsense 413 861 9 18
Genomic Location (Zv9):
Chromosome 3 (position 6297040)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5825326
GRCz11 3 5735247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGACACAGGTTTGGCCAGTGACGGCGGTGACCCTGCAAGATCCA[G/T]AGTGTAAAGCTGAATTTAACGGAAGTCATTTCCTGTTGGTTTCCCCCATC
Long Flanking Sequence:
TTTGTTCTCTTTACTCTCGTTACATTTAAAATTTTCTCAAAACATTTGACCTTATATTCTTAACATAGAAAAGAGTGTGTTGTTCACTAGTGTGTGTCTATAACGATGTGTTTTGTGATCTTCAGACTCTGATGATGCGTCTTCAGTCTGGCATCATCACGATGACATCACGATTGACAGTGCTGATGCGCTCAGCTATCAGTGTGAAGGCGGAGCTCTGACTGTTACCGTGGATATGCAGATGCTAAAGGTAGCAGACACACACACTGTATGATCCAGTGAACTAAAAATAAATGTTACACAAATATAAGTGTTGTAAGAAAAATGTGCAAGTGGGACGTGAAGGAAGAACAAGGAAGGGAACTGGCAAAAATCATAATAAAATAAATAATAATAATGCATATAATTATAATATCTGACCTATAATAATAATGCCAAACTGTTTGACCTGTCTGCAGACACAGGTTTGGCCAGTGACGGCGGTGACCCTGCAAGATCCA[G/T]AGTGTAAAGCTGAATTTAACGGAAGTCATTTCCTGTTGGTTTCCCCCATCATTTCCTGTGGTACCGAGGGAGAAATGGATGAAGCCAGTGGAAGGGTTCATTACACAAACACAGTGAGAGTAAAACATGATTAAACACATGCTGTATCTGCTAAAGCATCACACTTGTTTCTCAAGACGATTTGTGTTGCTTGTGTGATTTAAAAAATAGTGGCTCAGGTTTTGCTCTAAAATAAAATGTATTTATATACAGTATTTATACATGTAATAGAGTTCGTTGTTTGGGAAGAAGGAGGCGGAGAACCGACGCAGTTTTTAAACTATTTATTATTACAGTTTTTTACAATGGCTATGACACTTTTTTCAATAAATTTAACAAGTTTGCTAAACTCTTAACGCAGCAACACACCTAAAACACACAATTGGCAAAACAGTTAATTTTATGCTCAAAATCACACATTATAAACTAAACCTCTAAACTACTTTTCAAAATACAATAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25985
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125008 Nonsense 824 861 18 18
Genomic Location (Zv9):
Chromosome 3 (position 6273359)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5801645
GRCz11 3 5711566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACACAAAGCATGTTTGTGGTTTGTTTTTCAGGGAGGCATGATTTGACC[C/T]AGAGAATCAGTGTTATAGAGACCACTGTACCGAACCCCGGCTTCATAAAC
Long Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACACAGCAACAAACAAGCTAAACACAGCATCGCGCTATTTCATTTACACACATACATTCATTTACACCCATGTCATCCTCTACTCTGCATCATGTCAGTTTGTTACACAGAACTTCATTTGTAAACTAATTAGATTTGTTTTCCTTGCATGTATTGATTCCTTCGGTTGTTACCAACATCTGGTGAACATTTCAAGTCAACAGCACCTTTAGAAATATGATTGAAATATGATAAATGGTGACGTGTTCAACACTTATTTACCCCGCTGTATATTGATTATTGTGACAGGCCTAGTCATTGATCCATTTCACACGCAAAATGAAACATTTCACGGCTTCAAATAATGTAGCCCTGGGCACATATTCCCAATAAGCCTGTGCGGTGGAAATAACCTACCCAACACAAAGCATGTTTGTGGTTTGTTTTTCAGGGAGGCATGATTTGACC[C/T]AGAGAATCAGTGTTATAGAGACCACTGTACCGAACCCCGGCTTCATAAACCCGCCAATACTAATGGAGGAAACCAGCAGTTTCCATGATGTCAACGACACACACAACAACTTTTAGGAAATGAGCAAAAGCAAACATGTTTGATGTGATTTGTGCATTCTGTAATCAGTATCTGTAAGTGAGCAGTTTCCTGTATTTTGTGATCGATGTTTTTGTTTTTCCTCTTTTATTCCTGCTTTTGATTTGCATTATGGGATCTTGATCTTTCTTCTTTCAACTCTTAACCTTGAAAAGTGTGAAAAGGTGTATTTTTTGAGCACGTGTAATAGTCTGCAGTGCTCTATTGTCTGGGTTGGTGTTGCAGGCCCGGATTGGCTAATCGGGAGGACCGGGAGAATTCCCGGTGGGCCGGTCTGTTTTTTGGCCGCGAGGGCCGGTGTCCCTAGCTCCAGAATCTGTGAGACACTGCTCGCTGCAGAGCCATTTGAGCAGAGCTGAGCT
Associated Phenotype:
Not determined