Busch Lab

ZMP

si:ch211-224l10.4

Ensembl ID:
ENSDARG00000088762
ZFIN ID:
ZDB-GENE-090312-125
Human Orthologue:
MFSD2A
Human Description:
major facilitator superfamily domain containing 2A [Source:HGNC Symbol;Acc:25897]
Mouse Orthologue:
Mfsd2a
Mouse Description:
major facilitator superfamily domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1923824]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37653 Nonsense Mutation detected in F1 DNA Not yet available
sa11165 Essential Splice Site Available for shipment Available now
sa44996 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37653
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125449 Nonsense 48 508 2 14
ENSDART00000132573 Nonsense 48 469 2 13

The following transcripts of ENSDARG00000088762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 16907588)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16810527
GRCz11 23 16736870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTATGAAATGACTATAACCGTCAAGGTCTTTTTCATGCAGATCTTTT[T/A]ACTGGATGTTGTGAAGGTGAGTACAAAAGATTTGGTTTTGCAGCTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11165
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125449 Essential Splice Site 54 508 3 14
ENSDART00000132573 Essential Splice Site 54 469 3 13

The following transcripts of ENSDARG00000088762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 16904728)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16807667
GRCz11 23 16734010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGAATTTTTACATTTTCTTTTGTGCATGTTTTATATATAAATATATA[G/A]ATGGAAGCCTTTTATGCATCCCTCATTCTCTTCCTCGGTCGAGCTTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44996
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125449 Nonsense 280 508 8 14
ENSDART00000132573 Nonsense 280 469 8 13

The following transcripts of ENSDARG00000088762 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 16898809)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16801748
GRCz11 23 16728091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTTCCCTATCTAACTGGAATTAAGATGGTTGTGAGACACACTCCATA[T/G]GTACGGCTTGTATTTGGATTCCTCTTTTCTTCACTAGCCTTTCAGGTCAG
Associated Phenotype:
Not determined