Busch Lab

ZMP

ENSDARG00000088733

Ensembl ID:
ENSDARG00000088733
Human Orthologues:
AL049692.1, EGR1, EGR2, EGR3, EGR4, WT1, WT1, WT1
Human Descriptions:
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:HGNC Symbol;Acc:12796]
Wilms tumor 1 [Source:UniProtKB/TrEMBL;Acc:A0FJ58]
early growth response 1 [Source:HGNC Symbol;Acc:3238]
early growth response 2 [Source:HGNC Symbol;Acc:3239]
early growth response 3 [Source:HGNC Symbol;Acc:3240]
early growth response 4 [Source:HGNC Symbol;Acc:3241]
Mouse Orthologues:
Egr1, Egr2, Egr3, Egr4, Wt1
Mouse Descriptions:
Wilms tumor 1 homolog Gene [Source:MGI Symbol;Acc:MGI:98968]
early growth response 1 Gene [Source:MGI Symbol;Acc:MGI:95295]
early growth response 2 Gene [Source:MGI Symbol;Acc:MGI:95296]
early growth response 3 Gene [Source:MGI Symbol;Acc:MGI:1306780]
early growth response 4 Gene [Source:MGI Symbol;Acc:MGI:99252]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12755 Essential Splice Site Available for shipment Available now
sa40281 Nonsense Mutation detected in F1 DNA Not yet available
sa20262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12755
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Essential Splice Site 15 289 1 2
Genomic Location (Zv9):
Chromosome 4 (position 18992078)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20068684
GRCz11 4 20057660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGGATGGAAGTGAAAGAGGAAAGTGAAGAACWGAGTGCAGATGAGAAAA[G/A]TCAGTATCAGGCAACCTAATTCAGGGTTTCTGTGGGTACTAAAAANNCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40281
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Nonsense 202 289 2 2
Genomic Location (Zv9):
Chromosome 4 (position 18994899)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20071505
GRCz11 4 20060481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCACCAGAAGTTACATAATGGTGTGAAGGAGCATGTTTGCTCGGTGTG[C/A]GGCAGCTGCTTTACTAAAGTGTACTATCTGCAACAGCACCAAAGGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20262
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106490 Nonsense 214 289 2 2
Genomic Location (Zv9):
Chromosome 4 (position 18994933)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20071539
GRCz11 4 20060515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGCTCGGTGTGCGGCAGCTGCTTTACTAAAGTGTACTATCTGCAA[C/T]AGCACCAAAGGATCCATACTGGAGAAAAACCGTACAAGTGTACACAATGT
Associated Phenotype:
Not determined