Busch Lab

ZMP

NP_001035448.1

Ensembl ID:
ENSDARG00000088706
Description:
mitogen-activated protein kinase kinase kinase kinase 2-like [Source:RefSeq peptide;Acc:NP_00103544
Human Orthologue:
MAP4K2
Human Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6864]
Mouse Orthologue:
Map4k2
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346883]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26917
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043952 Essential Splice Site 379 865 16 32
Genomic Location (Zv9):
Chromosome 7 (position 18911437)
KASP Assay ID:
2259-8583.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCTGCAGGGGTCTTCTGGAGTGTGTGGAGGAGGAGTTACAGCAGAGG[T/G]ACGTTTTTTTTTTTTTTTTTTTTTGATGCTGAATTTTGTACGCCATCTTG
Associated Phenotype:
Not determined