Busch Lab

ZMP

ENSDARG00000088672

Ensembl ID:
ENSDARG00000088672
Human Orthologues:
IL1R1, IL1RL1, IL1RL2
Human Descriptions:
interleukin 1 receptor, type I [Source:HGNC Symbol;Acc:5993]
interleukin 1 receptor-like 1 [Source:HGNC Symbol;Acc:5998]
interleukin 1 receptor-like 2 [Source:HGNC Symbol;Acc:5999]
Mouse Orthologues:
Il1r1, Il1rl1, Il1rl2
Mouse Descriptions:
interleukin 1 receptor, type I Gene [Source:MGI Symbol;Acc:MGI:96545]
interleukin 1 receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:98427]
interleukin 1 receptor-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913107]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa41555 Nonsense Mutation detected in F1 DNA Not yet available
sa31751 Essential Splice Site Available for shipment Available now
sa10057 Nonsense Available for shipment Available now
sa8912 Nonsense Mutation detected in F1 DNA Not yet available
sa34784 Nonsense Mutation detected in F1 DNA Not yet available
sa27498 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41555
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 71 580 2 11
Genomic Location (Zv9):
Chromosome 9 (position 54866476)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53501227
GRCz11 9 53040734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGATCGACTATCTCTTCGATCCTGAAGAAACATCATATAATGTGAGCTG[G/A]TACAATGTGAAGACCGGCTCAGAGATCACAGCAGTGGAGCACAGCGTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27499
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 235 580 5 11
Genomic Location (Zv9):
Chromosome 9 (position 54851572)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53486323
GRCz11 9 53025830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTAACAAATTGTGTGGTTTTTTTTTAGATGAATATTTAAAGAAACCA[C/T]AAGTCATCCAGCCAGTAAATGAGATCATCAGAATGGAAGAGGGTGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31751
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Essential Splice Site 345 580 7 11
Genomic Location (Zv9):
Chromosome 9 (position 54849227)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53483978
GRCz11 9 53023485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCAGCAGTCGAGGACATCTGACCGGCCAGTTCATGCTCATCCCAACAG[G/A]TACATCAAAAGAGTACCTAATCAGAAAATCTTTGCAAACCCTAAATAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10057
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 400 580 9 11
ENSDART00000122155 Nonsense 400 580 9 11
Genomic Location (Zv9):
Chromosome 9 (position 54845089)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53479840
GRCz11 9 53019347
KASP Assay ID:
2260-2603.1 (used for ordering genotyping assays)
KASP Sequence:
TTATTCTTCACTGTGGTTGTTTTTCCTYTAGATGGCGATGGTAAGCAGTA[T/G]GACGCATATATCGCCTATCCCAGAGTCCTGGAGGGCTCYAGTGAAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8912
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 400 580 9 11
ENSDART00000122155 Nonsense 400 580 9 11
Genomic Location (Zv9):
Chromosome 9 (position 54845089)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53479840
GRCz11 9 53019347
KASP Assay ID:
2260-2603.1 (used for ordering genotyping assays)
KASP Sequence:
TTATTCTTCACTGTGGTTGTTTTTCCTYTAGATGGCGATGGTAAGCAGTA[T/G]GACGCATATATCGCCTATCCCAGAGTCCTGGAGGGCTCYAGTGAAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Nonsense 485 580 10 11
Genomic Location (Zv9):
Chromosome 9 (position 54837341)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53472092
GRCz11 9 53011599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACGGCCTCTTCCCTCTGCAGTCCCGAGGCGCAGGAATGGGCGGAGCAG[C/T]AGACGGGGCTCCACCGTGCACTTGTTGATCACTCCATGAGCATCGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122155 Essential Splice Site None 580 10 11
Genomic Location (Zv9):
Chromosome 9 (position 54835819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53470570
GRCz11 9 53010077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTATACTCTGGAGGTGGAGGGAAAAGACACTTTTCAGGAGACGTTAG[G/A]TTAATTTTAATGGGACGCCCAGTTCTTCAGCAGAATTTCTTTTGCAAAAA
Associated Phenotype:
Not determined