Busch Lab

ZMP

si:dkeyp-73e12.6

Ensembl ID:
ENSDARG00000088654
ZFIN ID:
ZDB-GENE-091204-395
Human Orthologue:
TEX15
Human Description:
testis expressed 15 [Source:HGNC Symbol;Acc:11738]
Mouse Orthologue:
Tex15
Mouse Description:
testis expressed gene 15 Gene [Source:MGI Symbol;Acc:MGI:1934816]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa41586 Nonsense Mutation detected in F1 DNA Not yet available
sa11305 Nonsense Available for shipment Available now
sa21645 Nonsense Available for shipment Available now
sa21646 Nonsense Mutation detected in F1 DNA Not yet available
sa34830 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41586
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 127 2152 3 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6176058)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7619225
GRCz11 10 7577925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGATTCTGCTTTTTAGCGGCAACAGATCAAATGACGACCCAGATTTA[T/A]CAGCATGGTCTGCCGGTTGGCAGCACAACACAGCATGCCTTGGGAAAGCC
Long Flanking Sequence:
CTGACACCGTCAACGTAAATCTTAAAAAATTCACGTCTTATGATGCTGTGTGTCTGCTGGGTATAGAGCATTTGATTGGTCAGAAGATTTGATGAGAAACTCAAGCATGAGGTAATGTCAAAAAAATTTATTCATTTAGGCAGAAGTGACAAACTGCAAACTTTGAGCACTTATATCTTCTAAATGCGAATTTTGTTATAAATTTTGTTGTTTTGGATCACTCAAACTTCTAGATATCTTTATAACAAACATACTGATTTTAAATTCATGGGACCTTTAAGCATGCAGCACCTTCACTGGTGCAACATCAAACATCAGTTATCCACCAAAAATGAATTATCCTCAATAAATTAATGTTGTTTTTTTCATTGCATGTCTGCCATTCACTATTCATTGACTAACTACAGGGCAGAGATGCGTGCTAAAGGAAGACATGGGAGAGAAATGGAGGAAAGATTCTGCTTTTTAGCGGCAACAGATCAAATGACGACCCAGATTTA[T/A]CAGCATGGTCTGCCGGTTGGCAGCACAACACAGCATGCCTTGGGAAAGCCATCTTATGGAGTATATCTGTTCAAGCACGTTGATGTGGCATTGAAATCAGCCTGCACGAGTGCTAAAAAGCTGTTCATTTTCAAGGTTTGTTCATTATTTCCTTAGTCTATCTTAAAAGGATAGTTCTCCCAAAATTTAAAGTGTACTCACTGTTTACTAGCCCTCAAGTGGTTCCAAACCTTTTTAGATATTTTATTGAAAACTCAGTGGTTACAGGTTTTTATCATTTCGGAAAAAATTATGTCTTTTGTGTTCAACAGAAGAAAGAAACTCTAAAAGGTTTGGAACAAATAAAGGGTGACTAAATTATGACAGAATTATTTTTTTTCATTAAGCTATCCTTTTAATGGTACTATTTGCACAAGAATACAAAAAATATTAAAATTAAAAAGAAAATATAATTCTGTAATGTGCAGGAAGAGTTTAAAAAGCCTTATTTAGAGCTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11305
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 488 2152 6 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6180010)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7623177
GRCz11 10 7581877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTAGCRAATGATSAAAGTGCGCATGCCCCAATATTRCCTTCAATGAGGT[T/A]ATTCAAATTAAAATTCCAGAAATATGCTGCCTATTTCAAAATGAAYGAAG
Long Flanking Sequence:
GCAAAACACTCAGTCACTTAACCTAAATCAGCACTGGACTCCTGCCAGCGAGGACTCAGAATCTTCGAGCTGCTCAGTGCCAGTTGTGGACCACACTGCTCTCTCCGAAAACTGGCTGGGGAAAAAAGCCTTCCTGAGTAATCACAAACAAAATGCTGAAAGAAATGAAAACAAATGGAACTCGTTACCTCAAACTCCAGTGGACAAGATTTCCACTGTCGTGTATTCTTCACGCTTGGTTAGAGATCCTCGTCTATCTAGACAAGACGCAAACCAACAGACCAACTGCTTGAATGGAGAGGAAGCATACACAGACTCAGGATGTGATGATAGGAATTACAAATCAGTGCATCATAACCAAGAGAATAATTATGGATTTGCTGGAAGTAAGTGTGAAGATCCGTCAAGTATGAACCAGAATGATGCTGAAAAAGACCATCCCCTAAAATTCTTAGCAAATGATCAAAGTGCGCATGCCCCAATATTGCCTTCAATGAGGT[T/A]ATTCAAATTAAAATTCCAGAAATATGCTGCCTATTTCAAAATGAATGAAGAGGAAAGACATCAATACATTTGGGCACATGAAAACATGTCGCCAGAACAAAAGCAAGAGTTGGCCGACCGGATCGATTTTTACTACATTTATTATCAAAAGTACAAGAAAGGATTACTCTTTCCAAAACTGAACAAGGCAAAGACCTCCGGTCTCTCTCAAACAGAGCCTAAAGAAAGTATTAAACAAACAATAAACAATGAATTCAAACTGAATTTACGATGCGTTGATGCCGGAAGTCTGTCAGAGAACAATGATTTGTTAATCAAGGGTAATTGTAGCTCAACACACATTCATGAAACCACACATCCAGATCATCCACAAGGGTTGTTGAAAGAAATTGGAAAGGATTGCCTGCTAAAGATGCAGGACTATGTGCCTTCAGAGAAAACCTCATTACTGGAATTGTCGAATCTCAACATCACAGATGAAAACACAAATAAACAGTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27552
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 802 2152 6 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6180951)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7624118
GRCz11 10 7582818
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCAAAAATCAAAAGCATGTTTTCTCCTCAAAGGCTTTCCTAATGAGC[A/T]GACCCACAGACACAATTTCCAAGCCAAAAAACGATAATGAAGACCACTGC
Long Flanking Sequence:
CCTCATTACTGGAATTGTCGAATCTCAACATCACAGATGAAAACACAAATAAACAGTTTAAGCATATTAAGCAACCAAGTCCTTTAACATGTTCCTGCAATAAAGCTAAGCTCAATAACATTGAACACGAGCTCTGCAGAAGTGTGGATCTGCAGGAGAATGAATCGAATCCAAGTGTTAACTTGGTTGAAATACCCAACTCTGAGGATGCAAACAACATCACCATCATGAATATCGCAAGCTTTATGGAAGTCTCTAGCAGCCTGACATCAGATTGTAATCTCAGTTCTGTCATGCCAGAAAAGGAAAAGCAGAATTTGACAATCTGCAACAGTGTTAAAGATATGGATTCGTTTAAATATGAGAAATGCTGTGAAATATCTCCAGAGTTTGACATGGACACAGTACAGCAGGAATTGTACAGAAGGCTTCAACTTGATCAACTATTGCCAAGCAAAAATCAAAAGCATGTTTTCTCCTCAAAGGCTTTCCTAATGAGC[A/T]GACCCACAGACACAATTTCCAAGCCAAAAAACGATAATGAAGACCACTGCGAAGCTGCAACAAACCTAAACATGAAAAGCTGTGAAGATAATCATTTCACAGTTACTCTAAAAGCCAATAAAACATCTACTGATATTAATGAAATGCTTTCTCTCTCTGAGCGATTTTCAAAAATCAAAGTCCTTCAAACTAAAATGGGTAAAGGAAGGAACAAAATGAGGACAGGGACACATATGTGCAACAACGAAGGGAACAAAAAACATGTGATCTGTAATGCAGAACTAATACAACTATTAGCACAGAAGTACAGCAAATCCAAAATCTTGAAATGCAAGAGATTACACAGATCAGACAGGAAAAAGATATCTTTCAAAAAACAGCACACAGCTCTAACACTAGGTCACTCCTTCAAGAGAAGGAAATATGTCAAGAAAACACATTTTTGGCAGGCAAAAAAGAATCGTAGCAGAACAGTACTGTGTCCCCATGCAACAGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 1102 2152 6 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6181851)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7625018
GRCz11 10 7583718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGAGAAGGAAACAAAAGATTTCACTTCACGAGTAATGGTGGATAAA[G/T]AAGAACAAATGGCGACTAAAAGCAGCTCAAATCAAAATAAAGTATGTTCA
Long Flanking Sequence:
GTCACTCCTTCAAGAGAAGGAAATATGTCAAGAAAACACATTTTTGGCAGGCAAAAAAGAATCGTAGCAGAACAGTACTGTGTCCCCATGCAACAGTCAATCCACATACATCTAAAACAGTCATCACAGACAACAAAGATCCAGACCCAGGCTCCAATTTAAGAATAACATCTGAAGACGATGTTGGCGAACAGAATGCTAATGTTTTTGGAAGCATACCCCAAGATCACTGTAGTCCAGTCATGTCAGTTATAAGCAAAGATCTCCCACCATCAATGGAATTCAACACTATTCCTGAGACTAAAGAGGAACCAATCAATAGTAAAATAAGATCAATAAGCAAAAATCTCCCACCATCAATGGAATTCAACACCATTCCTGAGACTAAAGAGGAACCAATAATTCTGACAGAACCATCTTTAGAAAATCTAAGTAAATGTGATGCTGATTTCACTGAGAAGGAAACAAAAGATTTCACTTCACGAGTAATGGTGGATAAA[G/T]AAGAACAAATGGCGACTAAAAGCAGCTCAAATCAAAATAAAGTATGTTCAGTCGCATGCACTACTATTGATTACACCACAGTGTGCAAGGAGGGGAACATACTCCTGAAAGAGACATCAGAGACTGGATTGAATACATTAAACAAAGAACATTTTACACTTGAAATGTCTGATAACAATATAGATGCTTCTGAGAACTTGGCTACACGTGATTGTGAGGCATCAGAAACTGAAGTCCAAACAAGCATGACTCCAGAGGACAAGGTGATGGATACTATTGGTGATACATCAAAAACAGGGCCTATACCATGCACTTTGCAGAATATAAGCATGGAAGGTGTTCTAAATAATCAGTGTATTGAAGGAGGAGAACACACTCCAGCAGATATCCCAAATGAAAACAAATCATGTCTCGACATTACCAACACATCCGATGGCAATAGTGTTTCGAGTACTGAAAAGGAGGTGCTTAAAGACACAACACTGAATTCAAAGCCGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21646
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 1787 2152 6 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6183907)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7627074
GRCz11 10 7585774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCTGGAAAAGGTTCACAAAGTTATAATGACTTTTGTGGAAACACCAT[C/A]AGATCAGTTGCCAGGGACATTTGATGTGGGGAAAGCGGAGCATCTGTCCA
Long Flanking Sequence:
TCATCCCCCTGCACAAATCGATCTGAAATACGAAGCAATAAATTCTTACTTGGAGTTGCAGATGATGATGGAAGCTTGGCAGTTTGTGGACAACAAAATTAACTTTCTAAGAGGTAAACCTACGTTTAGGAGTTTGCTTTGGTATGATCCTTCTCTTTACGGAGAACTCTACAAGGGGGAAGTCGGCTTTCAGCAGCAGTCATCCTTGTTTGCTTCTTTTCAAAAGATCTTGGCACAAGAGGGCAATGATAAACTGCAGGAATATTATCATGCGGTGTCCTCTTTGCATCAACAGCTGCATGCGGCACCTGATGCTTCTTACTACATGTATCTGAAGAGCAAGCGTGAGCTCCTCGAGGCAGAGGCTGCACTCAGAAATCCACGTGATATTAAGAACTTCTTTTTATCTGTACCAATTGCTGCAACAATCAACTTTGGAGACAGTTTGGAAAACCTGGAAAAGGTTCACAAAGTTATAATGACTTTTGTGGAAACACCAT[C/A]AGATCAGTTGCCAGGGACATTTGATGTGGGGAAAGCGGAGCATCTGTCCATCACATGCAGATATATCCAAGAAAAAGAGCTTTTCATAAGGTCCTGCAAAGAAATGATTAGCAAAATATCGTGGTTTGGAATCGAACATCTTCTTTATGATGCCTCTAAGGTTCTTGTTTGGCAAGACATGAATCATGGTGCACCAAGTGAGGCTCTTGAGACATATAAGAATTCAAACCCACAGATCATTTTTGGGGTGACAGAGTCAGGTGTTACTCTTGTAAACAAAGTGGAGCACCTTCCTCCATCCACAGATAGACAGACTCCACAAAAGATTGAAGTTGCTAGAAAACGCAAATGTTTACAGTTATGGATGTCCTCTGAACCCAGTGTGTCAAAGGTAAGATTAAACATGAAATCCTTTCCTTTCATTTTCCTTCAGCTTAGGTCCTTTATTTATCAGGGGTCGCCACAGCGGATTGAACGATTTCAGCATATGTATTACGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 2107 2152 8 8
ENSDART00000133104 None None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6187040)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7630207
GRCz11 10 7588907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCAAACTGTAATGTAAATCAAAATTTGGTATCTTCTCCTCTCTCAGTC[C/T]AGGCTTTGACTCATGTTCCTGTGCCCAACACGATTACAACAATTCAATAC
Long Flanking Sequence:
CACATTGTGACGTGAATGATAAAGGCCCCCTTTTCCAAACAACTCCAGCCACCCATCTTGAGGAGCTGAGCCCTTACTACCCACTCCCTCGCAGAATGGATCCACAGTGGGGAATGGTTGGACGTGATGCTGTAGACTGGAAGACACCTAACACAGTCCCCCCCTCGCCTTCAACGTCTCATGCTCACTCCGAAATACACTCTCGTCTTCTGTCTAAAAGACGAAGGGCTGTTTCACATTCTTCAGACAGGAGATCTTTAGCAGACATACAAAGACCTCAATGGCCTTCGGTCTCAGATTCCCAAGCAACTTTACGAGGAGATTCTTGTGCTTCACGTTCAGCATTTGAGAGCGTTAAATATCAACAAAATAGCACTGCAGCGCATTGTTCTATGCTCTCACAACAGCAAGTAAACCAGTTCAGTTTAGCCATGACACAACCTTATAATTTACCAAACTGTAATGTAAATCAAAATTTGGTATCTTCTCCTCTCTCAGTC[C/T]AGGCTTTGACTCATGTTCCTGTGCCCAACACGATTACAACAATTCAATACCCTTACTTCCTTCTGAATGGACAAACATACACCACAGGCTCCACTGGAGCCATTCACCCTGATACTAGATATTATCCTAGCGCCATTTAGGGCTATACGGTACTTTACGATTGAATTTTATGTATATCTTTTACATGAATATCCCACTGCATCAATGCAGAGATCATGCATGCACTTGGTACTTTTAAGCAAATGTACTTAAATGGGTCTTTATATGTAAAATAACACACATTTTAGGAGAAATTCTCTATGTACTCTATATAACGCTATATTTTATAGCGTAATGTGTTGTATACAAGATGTTGATGTTACCTTTTTGTAATATTTATTGAAATTTAATAATTATTTTCTACAAAACATGTGAATAAAGAAATGGTTTGATCATTTTACAGATAATTTCCAGAGTTTTGTAAAGCAGTGTTTTTCCAAACTAGCCTTCTCCTTAACTTT
Associated Phenotype:
Not determined