Busch Lab

ZMP

adcy1b

Ensembl ID:
ENSDARG00000088634
ZFIN ID:
ZDB-GENE-100805-1
Description:
adenylate cyclase type 1 [Source:RefSeq peptide;Acc:NP_001161822]
Human Orthologue:
ADCY1
Human Description:
adenylate cyclase 1 (brain) [Source:HGNC Symbol;Acc:232]
Mouse Orthologue:
Adcy1
Mouse Description:
adenylate cyclase 1 Gene [Source:MGI Symbol;Acc:MGI:99677]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32815 Nonsense Mutation detected in F1 DNA Not yet available
sa6821 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19643 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32815
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131177 Nonsense 17 834 1 17
Genomic Location (Zv9):
Chromosome 2 (position 199641)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 167767
GRCz11 2 155220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCATCTTGTTTGCTGATATCGTGGGCTTCACCAGTCTGGCGTCTCAGTG[T/A]ACGGCGCAGGAGCTGGTCAAACTCCTCAATGAGCTCTTCGGCAAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6821
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131177 Essential Splice Site 233 834 5 17
Genomic Location (Zv9):
Chromosome 2 (position 191726)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 159852
GRCz11 2 148811
KASP Assay ID:
554-4200.1 (used for ordering genotyping assays)
KASP Sequence:
AGGCTGAGATTCCCTTCTCTAACGTCATGAACTGTGAGGATGGGKACAAG[G/A]TATGACTTCAGCTGTCTGTGATTCTGTGTCAGTGACCGTCTGTGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19643
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131177 Essential Splice Site 233 834 5 17
Genomic Location (Zv9):
Chromosome 2 (position 191725)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 159851
GRCz11 2 148810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGAGATTCCCTTCTCTAACGTCATGAACTGTGAGGATGGGGACAAGG[T/C]ATGACTTCAGCTGTCTGTGATTCTGTGTCAGTGACCGTCTGTGTGTTTGT
Associated Phenotype:
Not determined