Busch Lab

ZMP

TRERF1

Ensembl ID:
ENSDARG00000088631
Description:
transcriptional regulating factor 1 [Source:HGNC Symbol;Acc:18273]
Human Orthologue:
TRERF1
Human Description:
transcriptional regulating factor 1 [Source:HGNC Symbol;Acc:18273]
Mouse Orthologue:
Trerf1
Mouse Description:
transcriptional regulating factor 1 Gene [Source:MGI Symbol;Acc:MGI:2442086]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42858 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42858
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129100 Nonsense 478 974 4 14
Genomic Location (Zv9):
Chromosome 17 (position 6006265)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6085201
GRCz11 17 6242431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACCCAGACCAAACTCACACTCCTGTGCCAGCAGAAAGATGATGGTT[T/A]AATAAAGTCTTGTGCGCAGACCCCCCTCCCACCGCTCCGAAACCACCCTT
Long Flanking Sequence:
TGAGAAACAGCCTCAATTAAAATGCAATACAATAGTATAGTTCATAATTATAACAATATTTACTATGAACAGAACTACCATAGTATTTTTCCATGTGGGAATAAGATGAAAACCGACAATGAATGAATTTAAAACACTTAATTTATAAGTTTCTTATCTGACTGATTGATTTTAATTTGATGCTTTCTGTCTGTTTTGTAACTCATCTGAATAGCGCATATTATTGAATCTCTGTCCACTGATTGGCTGTTCAATTTGTATAATAATTGTGTAATCCTGTTTCTGTTGCTTCCAATCTAAAGTGTCCTTTTATGTTTGAAAGGCACTTTATAAATTACACCTATCATTATTTTTTTTTTTTTAACAGAGAGACGGGCAAATGAATATGTGTGCTGAAGTTCCTCAGGGGAACCCCATCATCTTACCCGTTTCAGTCCCAGTCAAGAATTACCAAACCCAGACCAAACTCACACTCCTGTGCCAGCAGAAAGATGATGGTT[T/A]AATAAAGTCTTGTGCGCAGACCCCCCTCCCACCGCTCCGAAACCACCCTTCCTGTGTGAGTTTCTGTCATTCAGACAGCTATTTTTAGCAAGGGTTTAGAAAATTAAAATTGTGGTCTCAAATATCACTTCAGCTTTCTGAGAATTGATAAACTGTTGATGCTTAAAAAAAATAAATGGGGTTGGGGGGGTAGACATGTTGTTGTATTTTTCTGCACAGATGCTTTAAAGGTGAAATGGCACTTAATTAATCCTTAATGCACTTTTTAACTTGTTTAAGTCAAAATTGGACTTGCCTTCATATAAAAAAGCGTAAATTACAGTTGTCATGTATTTCTTTTCAATTACAGGTCATGTTTTTTCTGTGAATAATATTTGTAAAGGAGCTGTTGACATAAAACTGAACCAGATTTTGGTGAAAACTAATTACACAGCTATATCGTTATCGGCAGATAAATGCTAGTTTTAATGTTATCGTTATTTGTCCGATGTCAAAATTAG
Associated Phenotype:
Not determined