Busch Lab

ZMP

LOC799435

Ensembl ID:
ENSDARG00000088630
Human Orthologue:
ARHGEF10L
Human Description:
Rho guanine nucleotide exchange factor (GEF) 10-like [Source:HGNC Symbol;Acc:25540]
Mouse Orthologue:
Arhgef10l
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 10-like Gene [Source:MGI Symbol;Acc:MGI:1920004]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa30949 Nonsense Mutation detected in F1 DNA Not yet available
sa44742 Nonsense Mutation detected in F1 DNA Not yet available
sa35105 Nonsense Available for shipment Available now
sa21933 Essential Splice Site Available for shipment Available now
sa31839 Nonsense Available for shipment Available now
sa31838 Nonsense Available for shipment Available now
sa38849 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30949
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 172 1342 4 27
Genomic Location (Zv9):
Chromosome 11 (position 30413708)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29289694
GRCz11 11 29536868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGTTGTAATATGGCTGTATATTTGGGGAATGTTCCAGAGATCAAGCTT[C/A]AACAGACTCTACAGCACCAGAGGATTTAAATGAAGAGGAAGACCACACTT
Long Flanking Sequence:
TTTCCCATTTAGCACTCTAATGACTTTCATAACCGATTACATTTAAGCATATTAATATAATACAAATCCACATAAAGGGAGATATTTAATGCTAAATGAAATGCAATTCTGAAGGACTGTAACATTTTGAAGCATGATAACACCATGCAATAAAATATGTTTATCATCTTTTTTATTAAGTAGAAGGTATTAAGTGAAGATTAAATAACTTACATAAGACTGGACACATTACCATCTACATTCATACATACTGTACACCGTAAAAGCAAAATTTCCATCTCATTTCCATTTTCTCTACACAAAACACTGTGGCACACAAGTGAAAACACAAGTGCTTTTTGTGATGCTGACTATGTGGGGCTGATGGCATCTGAACTCTTCCCCTTCTCTCCTACACCCACCATCTAGTATTAGTTTTGAACTGATCTCAGTACGGTTATATCCTAGAAATTAGTTGTAATATGGCTGTATATTTGGGGAATGTTCCAGAGATCAAGCTT[C/A]AACAGACTCTACAGCACCAGAGGATTTAAATGAAGAGGAAGACCACACTTGCACTGTGGTGAAGATCCAGAGAGATACATGCACTATTAAAACAAACGCAGGGACAGAGGATTTCAGACACAGCCCATCACAAAATGCTGAAGGTAAGAGAAAAAACCTCAAATTTGTTTTAAAATGGACACCACTAGTAATCAAATGAACAGTAATCAAACTGCACATTTTAGTTTGAATGGATATTAGATAATATCAGAAAACTAGTTTGTAAAACAATCCTCTGTTTATTATTGTTTCAATATTCCAATTAGTATTGTTCAATTATGTTAGGCAATATTTTATATTTATTTTATATTCAACCACATTCAGGATAATGCAGTGACAGTATGGCTATTTATCTGTGGTTCTGTAATCACCTTTTATCATTATTTTAAACATTAAAAGAACATATACAACAAAAGTGAGCATATACAGACTTTCCTTAAAACTTCATGAGACGGAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44742
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 216 1342 4 27
Genomic Location (Zv9):
Chromosome 11 (position 30413577)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29289563
GRCz11 11 29536737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACTATTAAAACAAACGCAGGGACAGAGGATTTCAGACACAGCCCATCA[C/T]AAAATGCTGAAGGTAAGAGAAAAAACCTCAAATTTGTTTTAAAATGGACA
Long Flanking Sequence:
GCATGATAACACCATGCAATAAAATATGTTTATCATCTTTTTTATTAAGTAGAAGGTATTAAGTGAAGATTAAATAACTTACATAAGACTGGACACATTACCATCTACATTCATACATACTGTACACCGTAAAAGCAAAATTTCCATCTCATTTCCATTTTCTCTACACAAAACACTGTGGCACACAAGTGAAAACACAAGTGCTTTTTGTGATGCTGACTATGTGGGGCTGATGGCATCTGAACTCTTCCCCTTCTCTCCTACACCCACCATCTAGTATTAGTTTTGAACTGATCTCAGTACGGTTATATCCTAGAAATTAGTTGTAATATGGCTGTATATTTGGGGAATGTTCCAGAGATCAAGCTTCAACAGACTCTACAGCACCAGAGGATTTAAATGAAGAGGAAGACCACACTTGCACTGTGGTGAAGATCCAGAGAGATACATGCACTATTAAAACAAACGCAGGGACAGAGGATTTCAGACACAGCCCATCA[C/T]AAAATGCTGAAGGTAAGAGAAAAAACCTCAAATTTGTTTTAAAATGGACACCACTAGTAATCAAATGAACAGTAATCAAACTGCACATTTTAGTTTGAATGGATATTAGATAATATCAGAAAACTAGTTTGTAAAACAATCCTCTGTTTATTATTGTTTCAATATTCCAATTAGTATTGTTCAATTATGTTAGGCAATATTTTATATTTATTTTATATTCAACCACATTCAGGATAATGCAGTGACAGTATGGCTATTTATCTGTGGTTCTGTAATCACCTTTTATCATTATTTTAAACATTAAAAGAACATATACAACAAAAGTGAGCATATACAGACTTTCCTTAAAACTTCATGAGACGGAATTTTTGAGGACTAATTGCAGTAAATGAATTTACATGGTGAAAAGTGTGATCAGGAAAACATTAAGTCCACATCAATTTTACAAGTGTCTAGAAACTGAAAGGTCTTCTCGTGGCCAGCTGCATAAATGCTATCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27798
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 372 1342 9 27
Genomic Location (Zv9):
Chromosome 11 (position 30396803)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29272789
GRCz11 11 29519963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGATGACACCGAGGATGATACAGGGTATCTGGATGTGATGGTATCT[G/T]AAGCAAAACACCCACCTGCACAACTGGGACCAATGCCAGATGGACTAAGC
Long Flanking Sequence:
AAAACATTGGAAGAAGAGCTGAGAGGGATATTTGATGCTCAGGAAAATTTTCTTGGTTGTCATAATGTCCTTCTGCACAATAGGGAATGATTACCATTTGGAAATAGAAACTAGGACGATGCTTTATACAATTGCAATTATAACGAAGCACCACACTGTGTATAGTACTAAACATTTGATTTGGAGGTTCTGTTATTTCTTTTAAAGTTTTAAGAGCCTGAAAAAGGCATTTGAAGATTTTAAGCCTTTGGGAAGAGCTACAAAATTGTATGTCGGATGTTTTACCTTTGTAGTCTTGTGGAGTGAAAGATGTTTGGATGTGACTTAGTTCCACCTGTTCTGTACTGAATGTACTTTTTTCCTTGTTTGTAATAAGATAGCAGAAGAATATGTATTCTTATCTTTGCAGGGAGACATAATATGTTTTGAACTTGTTTTTGTGTATCCTGTGTTCAGATGACACCGAGGATGATACAGGGTATCTGGATGTGATGGTATCT[G/T]AAGCAAAACACCCACCTGCACAACTGGGACCAATGCCAGATGGACTAAGCAGCCAGCAGGTGTGTGTATATGCATTTATTGGTATGAAAGTGTGTTTTAACTTGTTTGTTTATTTAATCCAAGCCAAAATATACACATTTAAGTGACCCTCATTAGGGTAGTAAAATTAACATAAATATAATATATTTCAATCAATAACAAGCACTTGAAACAGTTTAATATAGGCTTCTCTAAAACTTTAAATATTCACTTTATTTTATTTAGGGTAGATTATTATTTTATTTAACAACAAACACAATTTTATGGCAATTCATGTTCTAAAATTGTTTGAATTCGCATCTCTTCAAATATTATTAATTATTCTTGTTTATTGATAACTGACCAACAAAAGATATATTAAAATTACGATAAGAATTAAAGCAAACACTTGTGCTTTGGGAAATAACACTCATCGTAGACGTCACGGGATGACTAATCAGAATGGAACGTGTAGCTGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35105
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 563 1342 14 27
Genomic Location (Zv9):
Chromosome 11 (position 30378249)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29254235
GRCz11 11 29501409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGACATGCTGAAGAACACTCCCACTGGCCATGTGGACAGACTGCCCT[T/A]GCAACTGGCTCTGACTGAATTGGAGACCCTCGCTGAGAAACTCAATGAGC
Long Flanking Sequence:
ACTCGAGCCCGGTCGTCGTCCCAGCGGCCGGCTCCTCCTCCTCTGGGGCCTCCGCTCAGCCGACGCAACGCTGTGAGCTAAGCGGACAAACTGGTTGCATTGGGAAAGCCCTCCACTCGGGGGACGGAGCGGCGCCACACCCCCCCGCAGCGTTCGCTCGGAAAAAACTAAACGCGGCCTTACGTACCTCCGGCCACGTAAATCGCGGTCTCCAGAAATGTCCGCGGGGCTACGTTTCCAGAATGAGCTTGGGTTGAACTTATTATTTACAAACTGCTACTCTGATGATTTGAATTGCTGTTTTATCCTCACTTGCAAGTTGCTTTGGATAAAAAGTGTCTGCTAAATGACTACATGTAAATGTAAAGAAAACAATTGGCCTTTGATTGCAAAAGCGAAACAAAAAAGCATTCGGTGTGATCAGGGCCTGACTTACTATGTTCTCTGCCTTTAGGACATGCTGAAGAACACTCCCACTGGCCATGTGGACAGACTGCCCT[T/A]GCAACTGGCTCTGACTGAATTGGAGACCCTCGCTGAGAAACTCAATGAGCAGAAAAGGGTGGCTGATCAGATCACTGAGACACAGCAGCTGGCCCGCTGTGTCAGTGACCGTTCTCTCAGCAAGGTGAGGAAAACACACACATGCGCCCTTTTTTCTTCCTCAGCTGTGATGGCAGAATGATGCTGCTGCCGCCTTGATGTAATCAGAGGAGTGTAAATCCTAATCACAAAACCATTTCATGGTTTCTTTCTGACTTCCTATTTTCTTAGACCTTTTTGCAATTACTTTACACCAGCTGGTCCCAAGGTCATTGTGTTCACACTGCTCTCATTGTAGCGAACCACAGATGTGGTTCATCACATTAACTGTTACACTTGCGTTTGACAAGCAGAAAATGTCACAGTGCTTTAGTCTTAATTATGAAATGGCTGTCTATTATTCCATTTTATCTTTTGAAAAAAAATGCAATCACAAGAATGAGGAAATTAGCCACTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21933
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Essential Splice Site 605 1342 15 27
Genomic Location (Zv9):
Chromosome 11 (position 30368180)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29244166
GRCz11 11 29491340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTGTAAGACTTGCGTGTAATCAGTGTGTCCCCTGTCTTTTTCTTCA[G/A]TTGCTCAACTCGGAGCAGAGCTCTTTGATCCTTTGTGAGACGCTGATTGA
Long Flanking Sequence:
GTGCATAAAACTCAAATGGGTTTCTAAATTGAATTCAAATTGATGGAGCAGACCCTGCAAGTGAATGAACAATCAAAAGTGCTGCAACAAATGACATTTATTTGAAAGCAGTTTTAAGGTAAGTAAGGTCATAATGACATTATAAATGCCTCTTCAGTTTAGACATCATTCTAAAACTATTTATGTAATAAAAGAACCTTTAGTGGTCCTCTATTTTTATTGTACACATGCAGTCAAATTTAGATAGTTTGTGGATGCAACTTTGTGCTTGTCAATTCAGTTTGAAAGGAGTATTTTCTTCAAGATTGGCTTTTATTCCCACAACCTTTTCCACTACAAATCTACCACTGTGTTTCCAATCTTCTGTGGTGCCTGCCTGTGAACCTTCAAGTGTCTTATATGCCACGCTGTGGCCTCTAAGTAAGTGTGTAGCCATGTAATTGTAGCCTCTATTTTGTAAGACTTGCGTGTAATCAGTGTGTCCCCTGTCTTTTTCTTCA[G/A]TTGCTCAACTCGGAGCAGAGCTCTTTGATCCTTTGTGAGACGCTGATTGAGACGGTGTACGGTGAACGAGGACAGGTCCTCAAGTCTAAGGAGCGGAAAGTCTTTCTCTTCGGTGACGTGCTCATCTGTGCCAACATCAATGTCAAGTATGTGTCCTGTGCAAGGTCGATTGACTTTTTCTTTCTTCCTCCATCCCTCTTTTGACAGATTGTCGCTCATCAGCCGATCTAAATATGAGTCTCCTGAAGCATTACAGTGACGTTCCCCCCAAATACCCCCCAGTCAATGTTAGAGGGTTAGCTAATGGCTAAGGCACAGGACAGAATTGAGCAGAGTCAAATGGGCCATCATTATCTGGGGACAAATAGCGGGGTGTTTAGCTACAGAGACAGGAATTATCCCCATAGATCACTGGCATAAAGCGCTCTTCTGTTCCACTCAAATAGATTATCTATGACAGCTCCATTGATCACATCTCAGCAGTGCAAAAGGTAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31839
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 783 1342 18 27
Genomic Location (Zv9):
Chromosome 11 (position 30348025)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29224011
GRCz11 11 29471185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCCGCATCAAAGAAGACCAAATTCAGAACGCCAACAAGTGCCGTTTA[C/T]GACTGCAAGTTCCTGGCAGACCAGACAAGTAAGTGAAGAGGAAACTTGAA
Long Flanking Sequence:
CTGAGGCCAAAAACCACAATTAACATAAAAAAGTGTTTTTTATGTTTTTAATCTGGTATCAAGGTCTATTTATATATGGTTGGCTAAACAATGCCACATTTCACATGTGTATATTTGGGAAATAAATCAGTTTGTGATGTTTTATTCAGCAAGGATGCAGTGATTTCATCAAAAAATGACATAAAGACATTTATAATGTAACAAAAAAATATATATATAATAAGGCTCTTTGGTTAAACCTCCTAAACCTATTTTTTCATCTTTAGTTTTACTAAAATGCTCTGTATTTTTGTTCAGTCAGTAATGGTTTTTATAATTATTGCAGTAGTCTATAATTGTTAAACACTTAGAAAATCACTGAGATTGTGAATGCTTGTTGTCACTATTTGCTGCATTTCCAGAATCTGAACACCACAGTGGCGCAGGACTGGTGTTTGGCACTGCAAAGGCTGATCCGCATCAAAGAAGACCAAATTCAGAACGCCAACAAGTGCCGTTTA[C/T]GACTGCAAGTTCCTGGCAGACCAGACAAGTAAGTGAAGAGGAAACTTGAAACTTCGCTCAGTTTGACATGCCATGAATTTTATAAAAGCATCGTTAATGTTTTCTTGACTTCAACTACAGTGGTACAAATACATTTTTTAAAATAAAAATTTCATTAAATATAATTGGCGCTTTCAGTTTGTTCCACTGAAAAAGAGGTCATAAATATATCAATGACCCAATGGGCTGAATGCACAGCTTGGGTTTTTTCAGCCAATGTTAAACTTCCGGTGAAAGCTTAATGTGACTATTTTTAATTTCATACGTTTTCTTTTACAGCATTGCTGTTGTGATGGAATTCAAATATAATCAGTGAAATAGACTTTAGCGTTCATTTAGTTGTTCAAGCGTTAAAAAAAAAATTAAAGACCATATAAACGCAGGCGCCATCATTAGCAGCAGGCTAGCACAGAAACTCCATTGAAAATACTGGGGTAAAATGAATTTCCATATTTTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31838
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 924 1342 22 27
Genomic Location (Zv9):
Chromosome 11 (position 30266076)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29142062
GRCz11 11 29389236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACATCTTCTCCTTGAACAGACCCACACCTCGGCCTGTAAAATCCCTC[C/T]AGATGGGAGCTCAAGTGAGGTGTCTGGAGTATGTGCCTGAGCCCAGCCCA
Long Flanking Sequence:
AAGATGTTTGAAGTTCTCGGGCTGACGCTGGGAATGCATTAGGGGTGATAGCGCATGCATTTTAGAGGCTTTATCAAGTGGAAGACTATGAGTTAGATTTTTACGAGATATGTGATTTTAACTTTCCTGTTTTTGTGAAATTGAAATTGACAAGAATAAAATAACAGGGTTGAAAAGCATTAAAGTACACAGGAAGTGAAAGAGAGTTTTCTGCTGTTTGGAAATTTCCTCCGTCTTGTTCTTGGAACTGGAAGTGAAAGCACAAAGCTGGGGGAGTGTTTAAAAGTGGCAGAACAACACAAAGATCCTTCCATTCCTCTGCCATTTTCTTTCTCTACCTGTACAGTCATAGATATGAGAGCAGTTTTGGTTGGATGACTGCCCGTAATAGTGGTGCCCTTGCTCTGTTTTTGCAGGTAGCTAGTGGAGCTGATTCCACTCAAGGCCAGGTGGACATCTTCTCCTTGAACAGACCCACACCTCGGCCTGTAAAATCCCTC[C/T]AGATGGGAGCTCAAGTGAGGTGTCTGGAGTATGTGCCTGAGCCCAGCCCATCAGAGGATGCGGAAACCAGCCTGCACAGCTCCACTGAAGTTGGAAATACTATCTGTGTAGGACTTGATGATGGCAGGTAATATATAGACTGCTTAAAATGTGCAATATGTTCCTCAGTACAATTATAAAATACTTATTAATTCTGATAAAAATGTACTATAATAACACCAGTGTTGGGCAGTAGCGTTGCTACAAGTAGTGATGCTAGTAGCTTAGCTACATTTCTCAGTAGTGTGGTAATGTTGCTACTTTCTACATCAATTAGCTTTACAGTAGCCAAGTTGTTATCTTAAGCAAGTAGCGCAGTAACGTCCACAGAAGCTACATTTACCGATCACGGATCATTAAGTGACATTCACAGAGCTGCAATCAGGCAGTGTCTGGCCGATGAAAGTGAATACAAAATAGCAAGAATGACAAATTCTTTTTCTTTGTGTTTTACGGTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131165 Nonsense 1258 1342 27 27
Genomic Location (Zv9):
Chromosome 11 (position 30212397)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29088383
GRCz11 11 29335557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACCGTCTACGCTCAACCTCAGGGTTACCCGGACGGCCATTAACCGCA[C/T]GAGGAGACGAAGCCTCAGACTCATCTCTAGAGTCTCTGGAGCACAGCATG
Long Flanking Sequence:
TCAAAAGTTCTTCTTTTGTTCTCCACAGAATAGAAATATATATGCAAATGTTAATGGGAACTATGAAGGATGAACAAATTATGATCAATTTTTCAAGTTAATTTATTTCAAAGTAATTTCCGTATGCAATATGCACTTCAACATGTAATAATGCAAATCAGTTATCAAAGGTTCTTTCTGCTTTTTACTAATGAAAGCGATTTGTGATTTAATGTGGCCCAGGTAAGGGGATGATGTCCTTCAATGCTCACTGCGGGCCTGTGGATTTCTTAGTTGCCCTTTCCAGCACATTGTCCCCTGATCTTCTAAAACGGGACTCTGTGATAGAAGGTCACGATTCGGGCTGTGGAGTGGAGGACCGCAGCGACTCATCCTCTCAGGAATCCCTCCAGCAGCCCAGTGTTTCTACCCAGGTGGATGGAAAAGGGAAGGGACGGGGTGTTTTACTACAGTACCGTCTACGCTCAACCTCAGGGTTACCCGGACGGCCATTAACCGCA[C/T]GAGGAGACGAAGCCTCAGACTCATCTCTAGAGTCTCTGGAGCACAGCATGGAAGATGGCTCAATTTATGAACTCAGCGATGATCCAGACATGTGGGTCCGGGGTCGACCCTGCGAGAGGGAAGGGGTGAGGCGGGACAGGGTCACCTCGGTCGCAGTCATTTCGGGAGGTAAAGGTTTCCGTCGACTAAGGGAGGGATCGGTGACAGCCACTATGGAAAGCACACTTATGATCTGGCAGCTTCCTCTCACTGTTTGAGCTGAAATTTGTTGATTTACTCATCCTCATGTCATTCCAATACCCTCTTGACTTCCTCTTGAATTTATACACCGGTCACTCTTTTCAGTTCAGTTATGATAAATAGACCATAATTGGGTTTAAAGCTATGTTGAATTGAATGGAGATACGAGGCTGTGAGTGATAAACTAATCGAACACAGTTATGATGGTCTTAGAGAACAGAGTATCCATAACTTTTACTGTTGTTTTTTTTTTTTTTTTT
Associated Phenotype:
Not determined