Busch Lab

ZMP

RBPMS

Ensembl ID:
ENSDARG00000088558
Description:
RNA binding protein with multiple splicing [Source:HGNC Symbol;Acc:19097]
Human Orthologue:
RBPMS
Human Description:
RNA binding protein with multiple splicing [Source:HGNC Symbol;Acc:19097]
Mouse Orthologue:
Rbpms
Mouse Description:
RNA binding protein gene with multiple splicing Gene [Source:MGI Symbol;Acc:MGI:1334446]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9172 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127288 Nonsense 177 183 7 8
Genomic Location (Zv9):
Chromosome 7 (position 77056995)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 73887354
GRCz11 7 74144193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTGTCAGATTCGCTGGCTGCCRACTGCAGACACAAACCATCAGAGCT[G/A]GAAGAGTCGACAGTTCTGCTGATCAACATCTGTGAGTGTCTCACAYACAC
Associated Phenotype:
Not determined