Busch Lab

ZMP

ENSDARG00000088551

Ensembl ID:
ENSDARG00000088551

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44391 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129781 Nonsense 418 1005 1 7
Genomic Location (Zv9):
Chromosome Zv9_scaffold3554 (position 127412)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 35535346
GRCz11 4 35591646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTTCACTTACAAAGACAAGAAAGCAAATCCATTTCTTGATTCCTG[G/A]ATAAAGGAACTGGCATGGAAACTCTCTACAAAGACCCTGTTTAAACTTCA
Associated Phenotype:
Not determined