Busch Lab

ZMP

SLC29A2 (1 of 3)

Ensembl ID:
ENSDARG00000088521
Description:
solute carrier family 29 (nucleoside transporters), member 2 [Source:HGNC Symbol;Acc:11004]
Human Orthologue:
SLC29A2
Human Description:
solute carrier family 29 (nucleoside transporters), member 2 [Source:HGNC Symbol;Acc:11004]
Mouse Orthologue:
Slc29a2
Mouse Description:
solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27114
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123067 Essential Splice Site 85 144 4 5
Genomic Location (Zv9):
Chromosome 7 (position 75773709)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72110783
GRCz11 7 72628971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGCCTTTGCTGCTGTTCACGCTGCTCAACTCTATTCTCTATCCACGG[T/C]GAGAAACCTTCTGTTTTTAATGTGTTAATGCACTTTAAATGTTATTTTTT
Long Flanking Sequence:
TTATTTATAAATAGGATGTGTGCACTGTTGCTTACAGTGTTTAGTTTATGTTCTTATTAGTTGTTTTTTAAATGCCAAAATATGATGTTTTAAAAATTATTCAGTTTCAAATACTTAATTTCTAATTATTGAAGTAAAATTGACTTTTTCAAAAATAGATACAATTAAAAAAAGCATCTGTCATCAGCGACTCTGCTAAAACTGATTCAGTTACTCTAACATTGATCTTTTTATTTTTTGATCTGCTTTTCTCCAGTATTTCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTCAACACATCTGAATCGGGGAACGGAACGATAGCATCCGGAAAAGAGTATTATTTCAACAACTGGATGACGCTGCTTTCCCAGCTGCCTTTGCTGCTGTTCACGCTGCTCAACTCTATTCTCTATCCACGG[T/C]GAGAAACCTTCTGTTTTTAATGTGTTAATGCACTTTAAATGTTATTTTTTTTTATTTACTTGAAATTTATAATTAAATTATAAACATTTTAAATTAATTTAATGCATTTTGGAATAAGGCTGTAACATAACAAAATGTGTAAAAAGACTTTTCAGATACACTGTATATATGTGTGTGTATATATATGTGTATGTGTGTGTATATATATATATATGGTGTATATATATATATATAAGCTCTTTTCTATGTGAAAATATTTGAAATGCTATTCATTATGTATTTAATGTGTCCTGAAAGCAGCGATCTGCATCTTTGTGAATGATTCCTGTGTTTTAGGATCTCGGAGAAGATGAGGATTGGAGGAAGTCTAGTCTTCATCTTCCTGCTCTTCTTCCTCACTGCCGTCCTGGTGATGATCCCCATGGAGGAGGACCGGTTCTTCTCCATCACCATGGCGACCATCTGGTTCATCAACTGTGAGTGCCAAATTCACGGGATCT
Associated Phenotype:
Not determined