Busch Lab

ZMP

si:dkey-11f4.4

Ensembl ID:
ENSDARG00000088486
ZFIN ID:
ZDB-GENE-070912-360
Human Orthologue:
BPIL2
Human Description:
bactericidal/permeability-increasing protein-like 2 [Source:HGNC Symbol;Acc:16503]
Mouse Orthologue:
Bpil2
Mouse Description:
bactericidal/permeability-increasing protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:3026884]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12773 Essential Splice Site Available for shipment Available now
sa7167 Nonsense Mutation detected in F1 DNA Not yet available
sa27302 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12773
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Essential Splice Site 32 472 None 15
ENSDART00000134093 None None 98 None 3
ENSDART00000138006 Essential Splice Site 32 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 140922)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 343588
GRCz11 9 343221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATAATCCAGCATTCAAAGCTCTTCTGTCAGAGAAGGCTCTCACAGACTG[T/C]AAGTTTGCTKTATTTATTCAGTTAGAGGACACGTTTAGCTTTAATCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7167
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Nonsense 117 472 4 15
ENSDART00000134093 None None 98 None 3
ENSDART00000138006 Nonsense 117 197 4 6
Genomic Location (Zv9):
Chromosome 9 (position 136184)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 348326
GRCz11 9 347959
KASP Assay ID:
554-4571.1 (used for ordering genotyping assays)
KASP Sequence:
TTATKAGTAATGCTYATGCCTGTTCTCTGACTGCAGCACMGACAGCGGCT[C/A]RTTTGATGTGGAGGKCTACAATATATACATCYGTGTGGTCCTGGGGGTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27303
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Essential Splice Site 370 472 10 15
ENSDART00000134093 Essential Splice Site 76 98 2 3
ENSDART00000138006 None None 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 132636)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 351874
GRCz11 9 351507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGTTAAAGCTGACGACGCTCTGGTGCCTCTTTTCACACTGAATGTGG[T/C]GAGAAAACAAAGGAACTTTCAGAGAGAAAACACCCGTTAACAAGCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Nonsense 437 472 14 15
ENSDART00000134093 None None 98 None 3
ENSDART00000138006 None None 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 130901)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 353609
GRCz11 9 353242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCTTTGTGATTATCTTGTCTCAGCTCGTCTGAGGTCCGGCTTTCTCT[T/A]GCCCACGCTGCAGGGATTTAGCTTGAGTAACTCTCAACTGCTCATCAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27301
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121749 Essential Splice Site 454 472 14 15
ENSDART00000134093 None None 98 None 3
ENSDART00000138006 None None 197 None 6
Genomic Location (Zv9):
Chromosome 9 (position 130848)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 353662
GRCz11 9 353295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACGCTGCAGGGATTTAGCTTGAGTAACTCTCAACTGCTCATCAAAAAC[G/A]TGAGTATTTTAAATGAATGTTCATGTATTTAATGATGTTTTTGTTAATGT
Associated Phenotype:
Not determined