Busch Lab

ZMP

MBD1 (2 of 2)

Ensembl ID:
ENSDARG00000088407
Description:
methyl-CpG binding domain protein 1 [Source:HGNC Symbol;Acc:6916]
Human Orthologue:
MBD1
Human Description:
methyl-CpG binding domain protein 1 [Source:HGNC Symbol;Acc:6916]
Mouse Orthologue:
Mbd1
Mouse Description:
methyl-CpG binding domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:1333811]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18157 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8306
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127933 Nonsense 200 482 5 8
Genomic Location (Zv9):
Chromosome 8 (position 8419975)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7863521
GRCz11 8 7902322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCCCAGGTCAGAAAACACGGGAAATGGAGTTACACTTTTAAGGAAGAT[G/T]AAGACGACGCGGCCTATGTTGAGGATGTGGTTGATGCCAACATTGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18157
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127933 Nonsense 287 482 7 8
Genomic Location (Zv9):
Chromosome 8 (position 8423034)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7866580
GRCz11 8 7905381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCTATGGGTGAGGTGATCGGCTCGGTGCCCATGRCGGRCGAGATGAGC[C/T]AGAATGGATTTCTTCAGATCGAGATGGTGAAAGTGGGATCAWCTCCATCA
Associated Phenotype:
Not determined