Busch Lab

ZMP

ubap2

Ensembl ID:
ENSDARG00000088318
ZFIN ID:
ZDB-GENE-070424-16
Description:
ubiquitin-associated protein 2 [Source:RefSeq peptide;Acc:NP_001076307]
Human Orthologue:
UBAP2
Human Description:
ubiquitin associated protein 2 [Source:HGNC Symbol;Acc:14185]
Mouse Orthologue:
Ubap2
Mouse Description:
ubiquitin-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916176]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23872 Nonsense Available for shipment Available now
sa43594 Nonsense Mutation detected in F1 DNA Not yet available
sa44961 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 28 1169 1 27
ENSDART00000109292 Nonsense 27 1168 1 26
ENSDART00000136103 Nonsense 28 1169 2 27
Genomic Location (Zv9):
Chromosome 21 (position 10347836)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11831199
GRCz11 21 11923827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGCACTCGGGACAAAGCGCTGCCCACTACCACACAGACCACACAACCA[C/T]AGAAACAGCTTCAGGTGAGTAAACAACATCATATGGAAGCGTATGCCAAG
Long Flanking Sequence:
CTACAGGGTAGTTGTGAAGTGTTAACGGACACCAGTGTGGTCTCGTAGCATGGTCTTCATTTCAGCAGGGCTGGGATCAGCTCGATTGTTGTTTTTTCTACAAGGGTTTCTGGCGGTCAGAGTATTGCTCAATCTTGCCCAACTGGGTTTAGGAGAAAGGAAATCCGATACGGCCCCTGTGTGTTTGCCTGACGCTGCGCGGGACACTGTAGAGAAGATCTGCAGAAAACGTCAGCTAGCTTGCTAGAACAAAACCTCTTCTGATGTCTGCAAAATATTTGGATTAGAAACTAGGACATGGAAGTGTTTTCCGAATAATAACCGCTTCCTGTTTTTTTTTTTTTTTTTTTTTCTGCCCTTGTTCTTTTTCCTTCCAGATTTTTCTGTTTTGTACATACATTGTTTTGTATATACTGTATATGATGAGCTCAGTGGGCGTCGAACGAGCCCGGGGCACTCGGGACAAAGCGCTGCCCACTACCACACAGACCACACAACCA[C/T]AGAAACAGCTTCAGGTGAGTAAACAACATCATATGGAAGCGTATGCCAAGTTAGGAGAATAACATAAAGCTGTTACTGTTTCTCCTTCCTGACCGTACTCTTCTGGATATTGTATGGGATGCAGTATGTTAGACTTGACCTTCTCATTTCCGCAGGCTGCATTTACATAAGACTCTGTTGCATTAAATAACAGCTTAACAGAGCGCATTGGGAAACAGTTTGATGTGGTGCTAAGCCAAACTTCTATACGTGATGGGAGGCTCGAAAAACCCAGCAAGACATGTGTTTTGCTTTAAAAAGGCATGAACTTTATAAGTGGGAACATGCTGCATGTCTGCTAATTAAAAAATACTGAAATAACAAGGCATGTAAATAAAAAAAAATCCAAGATAGATTAGTCATCTCCACAAATTGATTAGTCTGTAGATTAGTCACTATTTGTTTATATAACGAAATAATTGCAATGCTTTGTAAACAACAAGCTAAGTATGTACCATATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29535
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 286 1169 10 27
ENSDART00000109292 Nonsense 285 1168 10 26
ENSDART00000136103 Nonsense 286 1169 11 27
Genomic Location (Zv9):
Chromosome 21 (position 10358969)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11842332
GRCz11 21 11934960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTTGTTGCAGCCTGGATCTGTCAACTCTGCTGCAGAAGCCTGTGGAC[C/T]GAGAGGAGGTGGGAGGTCTCAAGGCCGTGGGCTCCTCTCAGGGGCTTGGC
Long Flanking Sequence:
AGTAAACTGATGACCTTCACGGCAAATCACAGTTATTTCTGTTGAGAACATGAACACAATGGCAAATCAGCGCTGTTTAAGAACGTGCTAAAGGATGTTTTTAAGGTGCTTAACAAAGTTTTTAAAATTCCAGTACTGATTGGTATCGAATTCCAGTATCGTGTCAACACTAATTTCTACCACCAAATAAAAACACTAACTGGCCCTTTTTATATATCTCCAAAGCTCTCTGAGACCAAAGTGTTCACTTCCTCTTGTGCACCTCCAACTGAGAACCACATCACACCTGGCCAAAGGTAATACGTTTAGCCCTTCTGTTCTCATTTTATAAGTCTGAGTTCAGCAAAGGCAAACTTTGAGAAAACTATTCTTTATTTCCAATCATGTGGTTGTTACAGCAGATACATCTTGATAATGATGCCTTGTGCTTATTTAACTGACCGTATTGTGGGTTTTGTTGCAGCCTGGATCTGTCAACTCTGCTGCAGAAGCCTGTGGAC[C/T]GAGAGGAGGTGGGAGGTCTCAAGGCCGTGGGCTCCTCTCAGGGGCTTGGCCACAGTCTGGTCTTCACCAACTCCCACCACCAGCCTGCTCGAAACGGAGGCACACCTGCTGGCTCCAACAGCTACACACATGCCACCCTGGTGAGATGATCCACAGGCCTGATTTATAGCACATACAGAGCTGCTTTTCTTCAGCATGAATCGCAGTGACCCATGTGAATGTTGTTGCTATGCTGTTTTTTTATTTTATTTAATTTTTCTTTCTAGTTAGTTGTGTGCCACTAGTGTGTGTATATTGATATCTGAATGGGTTTTCTGATGGCACCTTGCTTTTGTGTATTTCTTCAGTCCTCTGTTTTGGGTTCTGGTTTTGGAGAGCTGGGTGGTCCAAAACTCGGGCAGACGGCTGGGCAGCAAATACTGGAACAGCTGAAGGGGCCTGGTCTTGGGCAGCTTACCTCCCAGCCCTCTAGCACAGGGACCAACTGCACCCCTGTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43594
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 550 1169 13 27
ENSDART00000109292 Nonsense 549 1168 13 26
ENSDART00000136103 Nonsense 550 1169 14 27
Genomic Location (Zv9):
Chromosome 21 (position 10363911)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11847274
GRCz11 21 11939902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGCCCTGGACTTTGGTTCAGAATCTGCCCTGCCGGACTTCAGCCAAT[C/A]GGAGAACTGCAGCAGTGAACCCATAAGAGAGACTGCAGTAGTTTCTCAGT
Long Flanking Sequence:
TTCCAAAAATTGTATATATTATTTGATGGATCACATAATTATTTTTTTGTTTACTTCCGTTTAAAATATGGTGTGTGTGTGTGTCCGTGTGTGCGTGCGGGCGTGCGGGCGGTCTTTGGACATTTTTTGAGAGATGTTTCTAATAATAATAATATAATACTTTTATTGAATTTTCAGCCAATATGATTTTTAAATCTCATTCTTATGTGGTTATTTGGTGCTAAAGAAACAGTTTTTTTGGACCAGTCCAGTTCTTGCTAAATAAAATGTAAAACAACTTAATGACCTCATAAAAGAGGGTCATAATGTCAATGGTCAAAATAATTGAACTGATGTTTTATCAGCATGTACTGCCTGTATTTACATTCATGTCTTTGTGCACATCCAGATCCCCGCGTCTGCAGTAGAGATGCCTGGCTCAGCAGATGTGTCTGGTCTCAATGTGCAGTTTGGTGCCCTGGACTTTGGTTCAGAATCTGCCCTGCCGGACTTCAGCCAAT[C/A]GGAGAACTGCAGCAGTGAACCCATAAGAGAGACTGCAGTAGTTTCTCAGTCACAAAGCAGCCTTTACTCTAAACCAATCAGGTCAGTCTGGGTTAAAATGTAGCTATAATGGACACATAATAGTACTTGGTGAAGTCTAAATTAAATTGAAGTGCTTTTTCTTTTTCTTTGAGCAGTGGACATCTTGTTTTGCTGATGTTCCTAAATCTCTCAGAGCATGTCTTTCAAACCATTATACTCTCTTTAGCTTTAAAAAGAACAACAACTCTCCGATCTGCATGCTAATCTGTTTCCCATGATCTCCCCTGCAGTGAATCTCTGAGCAGTCCGGTCCCTTTGCTGCTGCCTCTGGCCTCTTCTGACAGCATCTACCCCTCTCCCTCAGTCCCTCTCCCAAGCCTCGCCCCGTCCCACAGCACCCCCAGCTCGGCCACAGCTCCCTCGTCCTCCTCTTCCTCCTCTTCCTCGTCCGCTGCATCATCGGCGGGGAACAGCTTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29536
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Essential Splice Site 662 1169 14 27
ENSDART00000109292 Essential Splice Site 661 1168 14 26
ENSDART00000136103 Essential Splice Site 662 1169 15 27
Genomic Location (Zv9):
Chromosome 21 (position 10364479)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11847842
GRCz11 21 11940470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCAAGACTGACCTTTTCACAGAGCAAGGAGCCTTCTGGACCTGTGACA[G/A]TGGGTGCAATTTAAGATGTTATAGCTATAAAGCGATGAAAATCAACACTT
Long Flanking Sequence:
TCTAAACCAATCAGGTCAGTCTGGGTTAAAATGTAGCTATAATGGACACATAATAGTACTTGGTGAAGTCTAAATTAAATTGAAGTGCTTTTTCTTTTTCTTTGAGCAGTGGACATCTTGTTTTGCTGATGTTCCTAAATCTCTCAGAGCATGTCTTTCAAACCATTATACTCTCTTTAGCTTTAAAAAGAACAACAACTCTCCGATCTGCATGCTAATCTGTTTCCCATGATCTCCCCTGCAGTGAATCTCTGAGCAGTCCGGTCCCTTTGCTGCTGCCTCTGGCCTCTTCTGACAGCATCTACCCCTCTCCCTCAGTCCCTCTCCCAAGCCTCGCCCCGTCCCACAGCACCCCCAGCTCGGCCACAGCTCCCTCGTCCTCCTCTTCCTCCTCTTCCTCGTCCGCTGCATCATCGGCGGGGAACAGCTTTGACTGCGGTGTGGCTCCTCACTCAAGACTGACCTTTTCACAGAGCAAGGAGCCTTCTGGACCTGTGACA[G/A]TGGGTGCAATTTAAGATGTTATAGCTATAAAGCGATGAAAATCAACACTTGAAAATTCTGTTTATAGTAGGGCTGCATGACATTAGGGGGAAAAAAACGTACATTGCTATATTATATTGCGATATTTCACAAGATAACTTGAATAGCTCTATTGGTGAAAATAGAATAACTTTCCATTAATTGGGATGATTTTGTGGGGGAGTGCATCTTCATAAAATCAAGCATAGATGAATGCAGTAGAGCAAATATACAAATGAAGCAGTCTAACAGTATTTACTAACAAAAACAAACTAATCAAATGTACAATAAAGCTGTATAGTCTTATTATATTAATAATTAAATGTTATTAATCTTTGTTAAAGCTACAAATATAAAGCCCAAATGCTTTAAACTTCTTTAAAATATTTAAACAGGTCTTAAAAACACCTGGGTCCTCATGTACGAAGACTTGCGTGGAAATCATACTAAAACATTGCGTACGCACAAAGCTGTAAATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44961
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092073 Nonsense 844 1169 19 27
ENSDART00000109292 Nonsense 843 1168 19 26
ENSDART00000136103 Nonsense 844 1169 20 27
Genomic Location (Zv9):
Chromosome 21 (position 10373327)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11856690
GRCz11 21 11949318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCAGGGGGTTCCTCCACTGCTGCCTAACCAGTACATCATGGGACCC[G/T]GAGGTCTGCTGCCTGCCTACCCGGTAAGAACCCTCATCCTCTTAATGCAG
Long Flanking Sequence:
AATATCCAAATCCAGCTAACTGAGTAATCCACGTACGAAGAACGGACCCCTGTACTGTTACTCACTATTGGTTAGTTAATAAAAATATTTTATAATAAAAGATTTTTTACAAATTTTTCTTTTGTAGTTTTGAAAGTCAAAGTATTGCAGTCATGCTGACCACCTTGTAGTTTTCAAATGTGAATTGTTTTATTCCACGCATACCTTTTTTGAAGTTTTTCTCTTTTGGTCAAAAATGGCATTTTCAGTATTTGGTAGAAAGAGGAAAAACTACCAAAATAAGTCGAAATCAAGGCTGTGCTGTGCCGCAACGCCCAGTAGTGTTTAGCACACTCTTTGTTTTAGTTAAATGGGAAATCACTGTTTATTCTCAGTTTGATTCTTTTCAACCGTTCACTCATTCTCTAACATCTCTTGTCTGCATGTGTGCAGGTAAAGCTCCTCCTAATCTCTCTCAGGGGGTTCCTCCACTGCTGCCTAACCAGTACATCATGGGACCC[G/T]GAGGTCTGCTGCCTGCCTACCCGGTAAGAACCCTCATCCTCTTAATGCAGATCCGCTTTCAGCCTTCTGAATGTGGAATTTCAGGATTTCTGTGTGCCAGTGTTTGTTTTGGGTTGGCCGAACTTAATGGTGTTGCTTTTATGCAGTGATGCATTATAGTGTGTGTCATTGCACGAGTAATAACTCGTGACTTTCAGAGAGTTTATTTGATGTGTTTACTATACAAGCTCTGATTCTTTGAAATAAATCTCAATTGAATTACTCTGTAAAATGCTGAAAGTTCCTGTGTTGTACAGCAGATTTATGGCTACGAGGACCTCCACATGCTACAATCCAGACTACCAATGGTAAGACTAAACCCATCAAATTCCCATTTAGAGCCGATGCTGGGCTTAATGCTTTCTTTTCAACTTCAGTTATATTGTCTTGTTTATTGCTTTGAGTAAAATGTTTATATTTGTCTTATTTTATAAGGTTCTGAACAGTTTTCTACCAATTTT
Associated Phenotype:
Not determined