Busch Lab

ZMP

CELSR2

Ensembl ID:
ENSDARG00000088231
Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Human Orthologue:
CELSR2
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr2
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15866 Nonsense Available for shipment Available now
sa43733 Nonsense Mutation detected in F1 DNA Not yet available
sa24041 Essential Splice Site Available for shipment Available now
sa19274 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15866
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 51 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 24222)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 94412
GRCz11 22 414017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCGCACTGGCGTGTGGGCCGCGGCCCGTTCACACAAACTCACCTGAGC[A/T]AGGTACTCAGACTGGCCGCGCGCTCAAACTCTGGGCTGCTGAGCAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43733
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 191 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 23802)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 93992
GRCz11 22 414437
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGCGACACAAATGATCACGACCCTGCCTTTGAGCAACAGGACTAT[A/T]AAGAGAGCGTACGAGAAAACCTGGAGATCGGTTACGAGGTCCTGACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24041
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Essential Splice Site 998 1222 1 2
Genomic Location (Zv9):
Chromosome 22 (position 21379)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 91569
GRCz11 22 416860
KASP Assay ID:
2261-6144.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACAACAACAGACCCCTGGAGGCATCCATGAAGATCTCCGTCTCCGG[T/C]AAGAGTTTATTAAATTGTGTTAACGAATGTGTTCTTACAAAAATCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19274
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003091 Nonsense 1007 1222 2 2
Genomic Location (Zv9):
Chromosome 22 (position 12432)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 115698
GRCz11 22 425807
KASP Assay ID:
2261-6143.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTTCTGTGGTCTGCAGATGGTGTGCACTCGGTGTCGGCTCAGTG[T/A]CTGCTGCAGGTCACCGTCATCACGGATGAGATGCTCTCCAACAGCATCAC
Associated Phenotype:
Not determined