Busch Lab

ZMP

ENSDARG00000088127

Ensembl ID:
ENSDARG00000088127

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa28012 Nonsense Mutation detected in F1 DNA Not yet available
sa30966 Nonsense Mutation detected in F1 DNA Not yet available
sa6273 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28012
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 5 249 1 5
Genomic Location (Zv9):
Chromosome 12 (position 45791438)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 44686376
GRCz11 12 45103194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTAAAACAAAGTCGCAGGTTTGAAATCACCACTGATGTGCTGTTTTT[C/A]GGGTTTCGTCTTTCTTAGGTACCCTTTCCCGACGGTCTTCAGCACGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30966
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 99 249 2 5
Genomic Location (Zv9):
Chromosome 12 (position 45798890)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 44693828
GRCz11 12 45110628
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGAAGGAGGAGGCCGTCTGTGCTCATGGACAGTGTTGTGAAAACTG[T/A]CAGGTAAATGCTGAAGTTTGCATGTTCTCTCCGTGTCCGCGTGGGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6273
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122637 Nonsense 211 249 5 5
Genomic Location (Zv9):
Chromosome 12 (position 45807172)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 44702110
GRCz11 12 45118853
KASP Assay ID:
554-4224.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTTCCTCCTGTTKTTTTCCAGAGATGCCAAATGTGGGAAGATCCAGTG[T/A]CAGGGTGGAGCCAACCGGCCGGYRATAGGCACCAATGCYGTTTCCATTGA
Associated Phenotype:
Not determined