Busch Lab

ZMP

LOC100331714

Ensembl ID:
ENSDARG00000088117
Human Orthologue:
FUT8
Human Description:
fucosyltransferase 8 (alpha (1,6) fucosyltransferase) [Source:HGNC Symbol;Acc:4019]
Mouse Orthologue:
Fut8
Mouse Description:
fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15676 Essential Splice Site Available for shipment Available now
sa43542 Nonsense Mutation detected in F1 DNA Not yet available
sa23819 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123851 Essential Splice Site 68 581 1 11
Genomic Location (Zv9):
Chromosome 20 (position 50967147)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50832302
GRCz11 20 50650347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTGAAGCAGCAGAATGAAGACCTACGTCGCATGGCTCAGTCRTTACGG[T/C]AAATWCACATATNNNNNNNNNCGCTCTTAGGGGCYRTTCACACTTTTAAATTCTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43542
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123851 Nonsense 332 581 8 11
Genomic Location (Zv9):
Chromosome 20 (position 51042280)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50907435
GRCz11 20 50725480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTCGCCTGCAGCGTCTTCACGGAGACCCGTCCGTCTGGTGGGTTTCG[C/T]AGTTCGTCAAGTTCCTGGTGCGTCCGCAGGCCTGGCTGGAGAAGGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23819
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123851 Nonsense 426 581 10 11
Genomic Location (Zv9):
Chromosome 20 (position 51053974)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50919129
GRCz11 20 50737174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCTTCTCTTGATATAATATTTGCTGGTGTTTTTCAGGTACACTGATTA[C/A]GAGTTCATTAGTGATAACTCCATCTCCTGGTCGGCCAGTTTACACAACAG
Associated Phenotype:
Not determined