Busch Lab

ZMP

SIK3

Ensembl ID:
ENSDARG00000088083
Description:
SIK family kinase 3 [Source:HGNC Symbol;Acc:29165]
Human Orthologue:
SIK3
Human Description:
SIK family kinase 3 [Source:HGNC Symbol;Acc:29165]
Mouse Orthologue:
Sik3
Mouse Description:
SIK family kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2446296]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18080 Nonsense Available for shipment Available now
sa42632 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18080
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122372 Nonsense 293 407 8 9
Genomic Location (Zv9):
Chromosome 15 (position 46464041)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47021073
GRCz11 15 47506156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGNNNNNNNNNNCGTGTGTGTGTTGCAGACGGACGGGCCGATGGCTCTRGATAGTGAT[G/T]AGGGAGAGGAGCCCAGTCCGGAGGCGATGGCCCGATACCTGTCTATGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42632
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122372 Nonsense 368 407 9 9
Genomic Location (Zv9):
Chromosome 15 (position 46462738)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47019770
GRCz11 15 47507459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCTGATGCCCACGCCGAGCCTGCAGCCCGGCCAGCAGCTGGAGTA[C/A]AAGGTACACACACACACACACACACACACACCAGTGTTTTCATCAGTCAG
Associated Phenotype:
Not determined