Busch Lab

ZMP

si:ch211-214c20.1

Ensembl ID:
ENSDARG00000088082
ZFIN ID:
ZDB-GENE-081103-49

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20298 Nonsense Available for shipment Available now
sa40310 Nonsense Mutation detected in F1 DNA Not yet available
sa31403 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20298
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126070 None None 889 None 7
ENSDART00000133110 Nonsense 31 577 1 2
Genomic Location (Zv9):
Chromosome 4 (position 28912250)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29666428
GRCz11 4 29621071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGAGAAGCTGAACTAAAAGAGTTTCAATGGTGCATAATAAATGACTA[T/A]AGAGATATTTCAAAAGCTGAAATGGAGAATGCAGACAGGTTGAAGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40310
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126070 Nonsense 74 889 1 7
ENSDART00000133110 Nonsense 172 577 2 2
Genomic Location (Zv9):
Chromosome 4 (position 28914156)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29668334
GRCz11 4 29622977
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGGATGGAGTTAAACCACAACCAACAGAAAGCCAAAGATAAACCGCTC[A/T]AGTTTAATGACATGTTTAAAGTTCAGCCTGACACAGGTCGACAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126070 Nonsense 592 889 3 7
ENSDART00000133110 None None 577 None 2
Genomic Location (Zv9):
Chromosome 4 (position 28916230)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 29670408
GRCz11 4 29625051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTGCTAGATAAATGCAAAATCATTATTTCTGTTTTTCCTCACAGCCTA[C/T]AGAGCTGTAATCTCACTGTTCAGTGCTGTAAGAGTTTGTCTTCAGCTCTA
Associated Phenotype:
Not determined