Busch Lab

ZMP

ENSDARG00000088021

Ensembl ID:
ENSDARG00000088021

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa429 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa429
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129159 Nonsense 12 132 2 3
Genomic Location (Zv9):
Chromosome 7 (position 71438666)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32051097
GRCz11 18 32021553
KASP Assay ID:
554-0195.1 (used for ordering genotyping assays)
KASP Sequence:
GATGTGTCTCTCAGCAGATTCGTCTGAGCAGATATATTAAGGAATATATG[T/A]TGTCAATCACTGTCGCATCTGTTGAGCACAAGAACACTGGCCAATGTAAT
Associated Phenotype:
Not determined