Busch Lab

ZMP

si:dkeyp-68f9.11

Ensembl ID:
ENSDARG00000088013
ZFIN IDs:
ZDB-GENE-060616-143, ZDB-GENE-081104-510
Description:
hypothetical protein LOC723999 [Source:RefSeq peptide;Acc:NP_001038769]
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa734 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa734
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100480 Nonsense 146 438 3 8
ENSDART00000108860 Nonsense 230 522 4 9
Genomic Location (Zv9):
Chromosome 9 (position 39481933)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38619829
GRCz11 9 38429624
KASP Assay ID:
554-0641.1 (used for ordering genotyping assays)
KASP Sequence:
CCATTCTCTTCGAGACGCGCATTGGCTGTCTGGAGAAAGAGATTCCTGTT[G/T]AGACTCAAGAGTTTATTAATTCAATTGCTCAAATGTTCACCTACAGCATR
Associated Phenotype:
Not determined