Busch Lab

ZMP

si:ch211-71n6.4

Ensembl ID:
ENSDARG00000088003
ZFIN ID:
ZDB-GENE-091204-213
Human Orthologues:
ACHE, BCHE
Human Descriptions:
acetylcholinesterase [Source:HGNC Symbol;Acc:108]
butyrylcholinesterase [Source:HGNC Symbol;Acc:983]
Mouse Orthologues:
Ache, Bche
Mouse Descriptions:
acetylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:87876]
butyrylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:894278]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29092
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122234 Nonsense 443 596 6 8
ENSDART00000146279 None None 77 None 2
Genomic Location (Zv9):
Chromosome 18 (position 43308033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44897924
GRCz11 18 44891378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAACGTGACCAGTCAGGCTCTGAAGCTCTACAATAGCTCAGCTCCATG[T/A]CCGACCTCTGATCGCTGTCCAGAAAGGCTCTTCACCACCATGGTCTCCGA
Long Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTCACTCATCTTGCAAATTACCTGGAAAAATATTATGTACTGTCATTACAGTAAAGACAAAAAAAGGGGTCATCATAAATGAGTTAATAAAACTTTTATTTTTGTTTAAAAAAAGTTTACTACACTTTGGAAATATTTGAAAAAGAATAATTTTGACTTTATCTGTGTGTTTTCCTCTAGGCCACCATATAAAAACATCTCAGCATGGATTTGGGAGGATTATCGATGGATTGTTAAAAGTATGTCAACTAATAAGACACATGCATATATATATATATATATATATATATATATATATAGTAAGTGAATGTGTTTCCTCACCACATACCTGTCGATCATTCACTCAGGTAAACTGAGCCCTTTCGGAGAGAACGTGACCAGTCAGGCTCTGAAGCTCTACAATAGCTCAGCTCCATG[T/A]CCGACCTCTGATCGCTGTCCAGAAAGGCTCTTCACCACCATGGTCTCCGACATGAAAGCTTCCTGCCCCAGAAATGACCTTGCTAAAAGAGCTGCAGGTTCAGATCCATTTTTCACTTCACAATTCAGGAAGCTTTATCAGCACTCTGAATATTTGATCATTCGTGAGCTGCAGTAAATATTTCATGATAAGTAGCTGTGTAAGCAGGATAATGTAGAGTAAGCAGTCATAATTGCAGAATAAACTTCCCCAGGATGATGCAAGACCCTTTAAGACTGACTGTACATTATCCTTAAAAGGAACAGTTAACATGTTTTTGAGCTATTCCAGCATTGTAAATGTGACATTTGCAGTAAATTCTCAAAACATAAATTCACATAGAAAGTATATGTTAATAATAAGAGTTATGGCATCAGAAAAATATCAATCTGAAAATATTTTTTATATTTTGAATAAGAGAAAATAAACATGCATCATGGATGTGACCAAAAAACGTTTGC
Associated Phenotype:
Not determined