Busch Lab

ZMP

NIPAL2

Ensembl ID:
ENSDARG00000087903
Description:
NIPA-like domain containing 2 [Source:HGNC Symbol;Acc:25854]
Human Orthologue:
NIPAL2
Human Description:
NIPA-like domain containing 2 [Source:HGNC Symbol;Acc:25854]
Mouse Orthologue:
Nipal2
Mouse Description:
NIPA-like domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924488]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42835 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42835
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122195 Essential Splice Site 81 115 3 4
Genomic Location (Zv9):
Chromosome 16 (position 57957466)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCGCCCCCGCATCACTCATCGCTCCGCTGGGGTGTGTGTCTGTCATCG[G/A]TGAGCGCACACACTCCTACATACACACACACAAACATGCGCACTCACTAA
Associated Phenotype:
Not determined