Busch Lab

ZMP

si:ch211-255l18.3

Ensembl ID:
ENSDARG00000087893
ZFIN ID:
ZDB-GENE-081104-199
Human Orthologues:
RNF216, RNF216L
Human Descriptions:
ring finger protein 216 [Source:HGNC Symbol;Acc:21698]
ring finger protein 216-like [Source:HGNC Symbol;Acc:33610]
Mouse Orthologue:
Rnf216
Mouse Description:
ring finger protein 216 Gene [Source:MGI Symbol;Acc:MGI:1344349]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa17630 Nonsense Available for shipment Available now
sa33273 Essential Splice Site Available for shipment Available now
sa40135 Nonsense Mutation detected in F1 DNA Not yet available
sa30838 Nonsense Mutation detected in F1 DNA Not yet available
sa33272 Nonsense Available for shipment Available now
sa15199 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17630
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Nonsense 290 834 4 16
ENSDART00000138783 Nonsense 290 834 5 17
Genomic Location (Zv9):
Chromosome 3 (position 40650930)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40514290
GRCz11 3 40656148
KASP Assay ID:
2259-3927.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGGATGCATATGTAGCAGAACTGATAGAGAGAGGTGACCTGAAAGATT[T/A]AAATGYGTAAGCACAAACTATTTTCTGCAAATTTTTGGTTTAGAAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33273
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Essential Splice Site 419 834 7 16
ENSDART00000138783 Essential Splice Site 419 834 8 17
Genomic Location (Zv9):
Chromosome 3 (position 40647805)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40511165
GRCz11 3 40653023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGAGCCAAATGAGCGCGCCTACATAGACTTCAAATTTGAGCAGGG[T/C]GACTATGTGTTTTTGTCCTTTCGTTTGCCTCTTAAATCCATCATCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Nonsense 479 834 9 16
ENSDART00000138783 Nonsense 479 834 10 17
ENSDART00000130058 Nonsense 479 834 9 16
ENSDART00000138783 Nonsense 479 834 10 17
Genomic Location (Zv9):
Chromosome 3 (position 40647384)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40510744
GRCz11 3 40652602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGCATGAAGACTTTCTTTTGGCTTTGCAAGTGAACGAGGAGCAGTA[T/A]CAAAAGGTGGGTGGGAAAAAACAGCTTTGTTAATGCCATGTCATAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30838
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Nonsense 479 834 9 16
ENSDART00000138783 Nonsense 479 834 10 17
ENSDART00000130058 Nonsense 479 834 9 16
ENSDART00000138783 Nonsense 479 834 10 17
Genomic Location (Zv9):
Chromosome 3 (position 40647384)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40510744
GRCz11 3 40652602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAGCATGAAGACTTTCTTTTGGCTTTGCAAGTGAACGAGGAGCAGTA[T/A]CAAAAGGTGGGTGGGAAAAAACAGCTTTGTTAATGCCATGTCATAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Nonsense 622 834 13 16
ENSDART00000138783 Nonsense 622 834 14 17
Genomic Location (Zv9):
Chromosome 3 (position 40613180)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40476540
GRCz11 3 40618398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGAAGTGCCATGTGGTGTGGAAGGAGCACGCAGGAAAGACCTGT[G/T]AGCAGGTGCTGGAGAGGGACGAGATCCGCCTGCGGGTGGCCTTGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15199
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130058 Nonsense 665 834 14 16
ENSDART00000138783 Nonsense 665 834 15 17
Genomic Location (Zv9):
Chromosome 3 (position 40610806)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40474166
GRCz11 3 40616024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACAAGTGTGCCACAGGTCTGGTGAAGTCGGAGGGCTGCAACCGAATGT[G/A]GTGCCGCTGCGGCGCCTACATGTGCTACCTCTGCCGAGAGCCAATCAACG
Associated Phenotype:
Not determined