Busch Lab

ZMP

ENSDARG00000087888

Ensembl ID:
ENSDARG00000087888

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8551 Nonsense Mutation detected in F1 DNA Not yet available
sa8628 Nonsense Mutation detected in F1 DNA Not yet available
sa5768 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa8551
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 233 509 1 1
ENSDART00000128128 Nonsense 233 509 1 1
Genomic Location (Zv9):
Chromosome 8 (position 1649021)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1418853
GRCz11 8 1466911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCSTCCATCCT[T/A]ACATCTTTCCACCATYAATCCACCTTCTCTTCRTCCATCCACCTACCCTT
Long Flanking Sequence:
CCTGTCTACTCTTCATCCATCCACTTGCCCTCCATCCATCCTCCAACCCTCTGTCTATCCACCTTCTCTCTGTCCACCCAGCTTCCGCCCATCCATCCTTCTACCCACCCTCCATCTATTCACCAACCTTCGCCCATTCGCCTTACCTACATCCTTACGCCTTCCCTTCATCCATCTGTCTACCCTTTGTCCATCTGTCTACCCTTTGTCTTTCCACCTTCTCTCTGTCCATCTGCCTTCCCTCCATCCATCCATTCGCCTTCCCTTCATCCATCCACCTTCTCTTCATCCATCCGTCTACCCTTTTTTCATCTGCCTATCCTTCATCCATCCACCTTCCCTCCGTCCTTACACCTTCCCTCCATCCATCCATCTACTCTTCGTCTATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCGTCCATCCACCTTCTCTTCATCCATCCTCCTACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCCTCCATCCT[T/A]ACATCTTTCCACCATCAATCCACCTTCTCTTCGTCCATCCACCTACCCTTCGTCCATCTGTCTACCCCTCGTCCTTCTCTCTACCCTTTGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCCCCATTTCATCCGCCTACCTAATATCTATCCACCTACCCTCCATCCATCCGCCTTCCTTTCATCTTTCCGCCTTCCTTCTGTCCATCCACCTTCCCTCCGTCCATCGTCCTGCTTACTCTCTGTCTATTCACCTACCCTTCACCCATTCGCCTTCCCTCCGTCCTTACATCTTTCCTCCATCGATCCACCTTCTCTTCTTCCATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCATCCATCTGTCTACTCTTCGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATATCTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCACCTTCCTTCTGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8628
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 233 509 1 1
ENSDART00000128128 Nonsense 233 509 1 1
Genomic Location (Zv9):
Chromosome 8 (position 1649021)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1418853
GRCz11 8 1466911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCSTCCATCCT[T/A]ACATCTTTCCACCATYAATCCACCTTCTCTTCRTCCATCCACCTACCCTT
Long Flanking Sequence:
CCTGTCTACTCTTCATCCATCCACTTGCCCTCCATCCATCCTCCAACCCTCTGTCTATCCACCTTCTCTCTGTCCACCCAGCTTCCGCCCATCCATCCTTCTACCCACCCTCCATCTATTCACCAACCTTCGCCCATTCGCCTTACCTACATCCTTACGCCTTCCCTTCATCCATCTGTCTACCCTTTGTCCATCTGTCTACCCTTTGTCTTTCCACCTTCTCTCTGTCCATCTGCCTTCCCTCCATCCATCCATTCGCCTTCCCTTCATCCATCCACCTTCTCTTCATCCATCCGTCTACCCTTTTTTCATCTGCCTATCCTTCATCCATCCACCTTCCCTCCGTCCTTACACCTTCCCTCCATCCATCCATCTACTCTTCGTCTATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCGTCCATCCACCTTCTCTTCATCCATCCTCCTACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCCTCCATCCT[T/A]ACATCTTTCCACCATCAATCCACCTTCTCTTCGTCCATCCACCTACCCTTCGTCCATCTGTCTACCCCTCGTCCTTCTCTCTACCCTTTGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCCCCATTTCATCCGCCTACCTAATATCTATCCACCTACCCTCCATCCATCCGCCTTCCTTTCATCTTTCCGCCTTCCTTCTGTCCATCCACCTTCCCTCCGTCCATCGTCCTGCTTACTCTCTGTCTATTCACCTACCCTTCACCCATTCGCCTTCCCTCCGTCCTTACATCTTTCCTCCATCGATCCACCTTCTCTTCTTCCATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCATCCATCTGTCTACTCTTCGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATATCTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCACCTTCCTTCTGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5768
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 379 509 1 1
Genomic Location (Zv9):
Chromosome 8 (position 1648582)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1418414
GRCz11 8 1466472
KASP Assay ID:
554-3535.1 (used for ordering genotyping assays)
KASP Sequence:
CCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATA[T/G]CTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCRCCTTC
Long Flanking Sequence:
ATCCATCCTCCTACCCTCCGTCAATTTGCCTACCTTCCCCCATTTGCCTTCCCTCCATCCTTACATCTTTCCACCATCAATCCACCTTCTCTTCGTCCATCCACCTACCCTTCGTCCATCTGTCTACCCCTCGTCCTTCTCTCTACCCTTTGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCCCCATTTCATCCGCCTACCTAATATCTATCCACCTACCCTCCATCCATCCGCCTTCCTTTCATCTTTCCGCCTTCCTTCTGTCCATCCACCTTCCCTCCGTCCATCGTCCTGCTTACTCTCTGTCTATTCACCTACCCTTCACCCATTCGCCTTCCCTCCGTCCTTACATCTTTCCTCCATCGATCCACCTTCTCTTCTTCCATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCATCCATCTGTCTACTCTTCGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATA[T/G]CTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCACCTTCCTTCTGTCCATCCACCTTCCTTCCGTCCATCGTCCTGCTTACCCTCTGTCTATTCGCCTACCCTTCACCTATTCACCTTCCCTCCGTCCTTACGCCTTTCCTCCATCCATCCCCCTTTCCTTCATCCATCTGTCTACCCTTCGTCCATTTGTCTACCCTTCGTCCATCTGTCTACCCTTCGTCCATCCACTATTCCTCAGTCCTGACCTCTCTGTCTAGTTGCCTTCCCTTCATCCTTTTCTTTCGTTCCTCCACCTTCCTCCAACCATCTGCCTTTCTTACGTCCATGTGCCTTCCTTCTGCCTTCCTTTCTTCCTTCTACTTGTTACCTTCCTTCCATCCTTACACCTTCTTTCCGTCTTTGTTCTTTCCTTCCTTCTGCCTTCCTTTCTTTGCCTTCCTTTTTCCTTCTGTCCACCTTCCTTCCCTACCTCCTTCCGTCCACCTTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5460
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128128 Nonsense 398 509 1 1
Genomic Location (Zv9):
Chromosome 8 (position 1648525)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1418357
GRCz11 8 1466415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCRCCTTCCTTCTG[T/A]CCATCCACCTTCCYTCCGTCCATCGTCCTGCTTACCCTCTGTCTATTCGC
Long Flanking Sequence:
TCCTTACATCTTTCCACCATCAATCCACCTTCTCTTCGTCCATCCACCTACCCTTCGTCCATCTGTCTACCCCTCGTCCTTCTCTCTACCCTTTGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCCCCATTTCATCCGCCTACCTAATATCTATCCACCTACCCTCCATCCATCCGCCTTCCTTTCATCTTTCCGCCTTCCTTCTGTCCATCCACCTTCCCTCCGTCCATCGTCCTGCTTACTCTCTGTCTATTCACCTACCCTTCACCCATTCGCCTTCCCTCCGTCCTTACATCTTTCCTCCATCGATCCACCTTCTCTTCTTCCATCTGTCTACCCTTCGTCCATCTGTCTACCCTTCATCCATCTGTCTACTCTTCGTCCATCTGCCTTCCCTTCATCCTTCTGCCTTTCCTCCATTCCATCCGCCTTCCCTATATCTATCCGCCTACCCTCCATCCATCCGCCTTTCCTTCATCTATCCACCTTCCTTCTG[T/A]CCATCCACCTTCCTTCCGTCCATCGTCCTGCTTACCCTCTGTCTATTCGCCTACCCTTCACCTATTCACCTTCCCTCCGTCCTTACGCCTTTCCTCCATCCATCCCCCTTTCCTTCATCCATCTGTCTACCCTTCGTCCATTTGTCTACCCTTCGTCCATCTGTCTACCCTTCGTCCATCCACTATTCCTCAGTCCTGACCTCTCTGTCTAGTTGCCTTCCCTTCATCCTTTTCTTTCGTTCCTCCACCTTCCTCCAACCATCTGCCTTTCTTACGTCCATGTGCCTTCCTTCTGCCTTCCTTTCTTCCTTCTACTTGTTACCTTCCTTCCATCCTTACACCTTCTTTCCGTCTTTGTTCTTTCCTTCCTTCTGCCTTCCTTTCTTTGCCTTCCTTTTTCCTTCTGTCCACCTTCCTTCCCTACCTCCTTCCGTCCACCTTCCTTCCTTCCTTCCTTCCTTGTCCACCTTCCCTCGTTCATTCACTCCTTCCTTCTACCT
Associated Phenotype:
Not determined