Busch Lab

ZMP

NLRP6 (11 of 83)

Ensembl ID:
ENSDARG00000087885
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30341 Nonsense Mutation detected in F1 DNA Not yet available
sa38155 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30341
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098333 Nonsense 352 881 1 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3487 (position 93459)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58926353
GRCz11 3 58985768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGTCCAACCGAGAAGTGATTGTCAAACTTGCTGAAGTGGCTTTCAAA[C/T]AGCTGATGAAGGGCAATGTGATGTTCTACAAGGAGGACCTGATTGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38155
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098333 Essential Splice Site 855 881 5 6
Genomic Location (Zv9):
Chromosome Zv9_scaffold3487 (position 99733)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58932627
GRCz11 3 58992042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTATGTGGACGTGTCCTCCGGCTCTCTGACCTTCTACAGCGTCTCCG[A/T]CACACTCACACACATACACACATTCAACACCGCATTCACTGAAGAACTCT
Associated Phenotype:
Not determined