Busch Lab

ZMP

wu:fa99e04

Ensembl ID:
ENSDARG00000087863
ZFIN ID:
ZDB-GENE-030131-9108
Human Orthologue:
CD44
Human Description:
CD44 molecule (Indian blood group) [Source:HGNC Symbol;Acc:1681]
Mouse Orthologue:
Cd44
Mouse Description:
CD44 antigen Gene [Source:MGI Symbol;Acc:MGI:88338]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa21059 Nonsense Available for shipment Available now
sa34175 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21059
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126240 Nonsense 60 392 2 8
Genomic Location (Zv9):
Chromosome 7 (position 51347337)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49617573
GRCz11 7 49890349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTCTTACCTTTCAGAAGGCTGGTGAACTGTGTCAGAGTTTAGGTTAC[A/T]GACTTGCAACACAAGAACAGGTCACTGAAGCCTATAAAAAAGGCTTGAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27044
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126240 Essential Splice Site 276 392 5 8
Genomic Location (Zv9):
Chromosome 7 (position 51344521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49614757
GRCz11 7 49887533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAGATGGTGGTTCCAGTAGAGACTTCAAATGTGAACCCCATTCAAGG[T/G]AAATGTTACTACAAATACACACTACATGTCTTTATATGCTGGATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34175
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126240 Essential Splice Site 302 392 6 8
Genomic Location (Zv9):
Chromosome 7 (position 51340665)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49610901
GRCz11 7 49883677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACAACAGAAAGTAATGCGAAGGAGATGGTTTCAGATGGATCGTCTTG[T/A]AAGTTCATGCAACAGCACTACAGAAGCCATAATTCTTCGATCTTTAATTA
Associated Phenotype:
Not determined