Busch Lab

ZMP

ece1

Ensembl ID:
ENSDARG00000087841
Human Orthologue:
ECE2
Human Description:
endothelin converting enzyme 2 [Source:HGNC Symbol;Acc:13275]
Mouse Orthologue:
Ece2
Mouse Description:
endothelin converting enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1101356]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35796 Nonsense Mutation detected in F1 DNA Not yet available
sa4586 Essential Splice Site F2 line generated Not yet available
sa35795 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4587
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Nonsense 80 767 2 18
Genomic Location (Zv9):
Chromosome 15 (position 4099948)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4245258
GRCz11 15 4236415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGTGTTGGCCGGTCTGCTTCTTGCTTCACTTCTTGCACTGTTCGGCTG[T/A]GCGGTCACACTGGGAGTCCGTTATAACAGAGGTAWTTCAAACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35796
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Nonsense 305 767 7 18
Genomic Location (Zv9):
Chromosome 15 (position 4065477)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4210787
GRCz11 15 4202259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGTTGGGAGGAGACAAGAATTCCACTCGGGGTCAGATGCAGCAGATTT[T/A]GGACTTTGAGACGGCGCTGGCGAACATCACCGTGCCCCAGGACGAACGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28396
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Essential Splice Site 460 767 10 18
Genomic Location (Zv9):
Chromosome 15 (position 4051963)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3987515
GRCz11 15 4189544
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAGCTCTTTTCGTCAAAGCCACCTTCGACAAACAGAGCAAAGAAATA[G/T]TGAGTTGCTTCATGTGTCGTATTACAGTTGAAGTCAAATGTATTAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4586
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Essential Splice Site 460 767 10 18
Genomic Location (Zv9):
Chromosome 15 (position 4051962)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3987514
GRCz11 15 4189543
KASP Assay ID:
554-3569.1 (used for ordering genotyping assays)
KASP Sequence:
GGGAGCTCTTTTCGTCAAAGCCACCTTCGACAAACAGAGCAAAGAAATAG[T/C]GAGTTGCTTCATGTGTCGTATTACAGTTGAAGTCAAATGTATTAGCCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Essential Splice Site 493 767 11 18
Genomic Location (Zv9):
Chromosome 15 (position 4049867)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3985419
GRCz11 15 4187448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATTTGAAGTGGATGGATGAACAGACCCGACAAGCTGCCAAGGACAAG[G/A]TGAGAGAGAGAATGAGATTTGCAGCAGCATGACTGGATCACCAAAACTTA
Associated Phenotype:
Not determined