Busch Lab

ZMP

wu:fj34h05

Ensembl ID:
ENSDARG00000087822
ZFIN ID:
ZDB-GENE-030131-7799
Human Orthologue:
AGAP3
Human Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:16923]
Mouse Orthologue:
Agap3
Mouse Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2183446]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa24533 Nonsense Available for shipment Available now
sa10330 Nonsense Available for shipment Available now
sa17974 Nonsense Available for shipment Available now
sa37933 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37932 Nonsense Mutation detected in F1 DNA Not yet available
sa37931 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24533
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 204 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35679283)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448963
GRCz11 24 34335138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTT[T/A]GCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGT
Long Flanking Sequence:
CAACGAAAGACAAGCGAATCAGAGGGAGGAGCGTCAAGAGAGCCCAGGGCAGAGGAGGAGCGCAGCTGGAAAGCTCAACAGGTGGCTTTACCTGAGCAGCACAGGGAACAGGGGGTGGAGGAAAGGGGAAGTTCTCGGAATGAGGACAGACCGGTTACCTATCCTCCGGGACAACTGTACGCAACAATCGTCTGCGGAACACTTTGACTTTGCTGGGGTAGAGAAAGCTTTGGAGCTCCGTACTGGTGTTTGCCACATTCCCTTTAAGGAACTAATTTGCAATGCTGTTTCTGTGGAGAATGCAACAGAATCTCATGTGGTGGTCTTGCAAAGGCCCGCACATGGGCTTCGGCTCCTGGGCAGCAGAAGAGCGATGAGCATGTTTGTCTTCCCAGACAACAACAGGAGACAGCAAACCACATCAACCAACCACCAAGACAGTTCTACAAGACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTT[T/A]GCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGTGTAGGACAAGGCGAGCTGAGCTGCGTGCCATCGATGGTTTAAAACCTGACATGCCGCCATCTGCCAGCCTGTTACCTCTTCGTCTAGAAGAACCGCCAATCCGACGGACTTTGAAAAGCAGGAGCAAACCAAGGCCTGTTAGCATGACTGTTCTTGAGCTTTATAAAGAGCGTAGTGGATCTCGGGATGAGCTTGCAAGCCATACTGGCACCGGTAGTTTGCCTCGTCCAGGATTCCGGTGGAAATGGTTTGGTCGACAGGCAACTGGAAAAGAAATGGGGGTGACACAAATTTCAGCAAAGCTGAAGGAATCTAACAAAGAAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTTTGAGCCTCCGGATGAGACGAAATCGTAATCAACCTGAGCATGAGGACAGAACTGAGCTGAGACGCACTGCAAGTATTGGAGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10330
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 317 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35678945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448625
GRCz11 24 34334800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGGAAATGGTTWGGTCGACAGGCAACTGGAAAAGAAAWGGGGGTGAYA[C/T]AAATTTCAGCAAAGCTGAAGGAATCTAACAAAKAAGAAGCACCCAAAAAA
Long Flanking Sequence:
CACATGGGCTTCGGCTCCTGGGCAGCAGAAGAGCGATGAGCATGTTTGTCTTCCCAGACAACAACAGGAGACAGCAAACCACATCAACCAACCACCAAGACAGTTCTACAAGACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTTTGCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGTGTAGGACAAGGCGAGCTGAGCTGCGTGCCATCGATGGTTTAAAACCTGACATGCCGCCATCTGCCAGCCTGTTACCTCTTCGTCTAGAAGAACCGCCAATCCGACGGACTTTGAAAAGCAGGAGCAAACCAAGGCCTGTTAGCATGACTGTTCTTGAGCTTTATAAAGAGCGTAGTGGATCTCGGGATGAGCTTGCAAGCCATACTGGCACCGGTAGTTTGCCTCGTCCAGGATTCCGGTGGAAATGGTTTGGTCGACAGGCAACTGGAAAAGAAATGGGGGTGACA[C/T]AAATTTCAGCAAAGCTGAAGGAATCTAACAAAGAAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTTTGAGCCTCCGGATGAGACGAAATCGTAATCAACCTGAGCATGAGGACAGAACTGAGCTGAGACGCACTGCAAGTATTGGAGAAAAATCTATGCAAAGCACTCGCCCATTCTCGTACCTTACTGGCAGGACGTTAGCACCAGCATGTGAGCAAGATGAGGACCAAGGGGCCACACAATACATACAGTACCAAACACAGGGCAAAGTAGCAGTCTTGGAGGTTCCTCTTCGACCTGCCAAATTAACCAAGCCCACTAAACAAATGCAGCCAGAGACTAGTTTTTGGCAGCTAATTGCTAGTCGTTTTAAGAGGAAGGAGCCGTTGTCCAGCAACAAATCTGAGCTGAGCACTGGAAGCCAAGCAGTTGGCAGCCATCCCCCTGTGAGAAATAAAAAGCCAGATTCTGTTGCTATAGAGACTCTAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5082
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 328 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35678912)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448592
GRCz11 24 34334767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAAAWGGGGGTGACACAAATTTCAGCAAAGCTGAAGGAATCTAACAAA[G/T]AAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTTTGAGCCTC
Long Flanking Sequence:
CGATGAGCATGTTTGTCTTCCCAGACAACAACAGGAGACAGCAAACCACATCAACCAACCACCAAGACAGTTCTACAAGACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTTTGCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGTGTAGGACAAGGCGAGCTGAGCTGCGTGCCATCGATGGTTTAAAACCTGACATGCCGCCATCTGCCAGCCTGTTACCTCTTCGTCTAGAAGAACCGCCAATCCGACGGACTTTGAAAAGCAGGAGCAAACCAAGGCCTGTTAGCATGACTGTTCTTGAGCTTTATAAAGAGCGTAGTGGATCTCGGGATGAGCTTGCAAGCCATACTGGCACCGGTAGTTTGCCTCGTCCAGGATTCCGGTGGAAATGGTTTGGTCGACAGGCAACTGGAAAAGAAATGGGGGTGACACAAATTTCAGCAAAGCTGAAGGAATCTAACAAA[G/T]AAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTTTGAGCCTCCGGATGAGACGAAATCGTAATCAACCTGAGCATGAGGACAGAACTGAGCTGAGACGCACTGCAAGTATTGGAGAAAAATCTATGCAAAGCACTCGCCCATTCTCGTACCTTACTGGCAGGACGTTAGCACCAGCATGTGAGCAAGATGAGGACCAAGGGGCCACACAATACATACAGTACCAAACACAGGGCAAAGTAGCAGTCTTGGAGGTTCCTCTTCGACCTGCCAAATTAACCAAGCCCACTAAACAAATGCAGCCAGAGACTAGTTTTTGGCAGCTAATTGCTAGTCGTTTTAAGAGGAAGGAGCCGTTGTCCAGCAACAAATCTGAGCTGAGCACTGGAAGCCAAGCAGTTGGCAGCCATCCCCCTGTGAGAAATAAAAAGCCAGATTCTGTTGCTATAGAGACTCTAGCTGGCATTGGTTTCCGCAAAGGTCAAGGTAAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17974
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 342 1047 1 13
Genomic Location (Zv9):
Chromosome 24 (position 35678869)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34448549
GRCz11 24 34334724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACAAAKAAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTT[T/A]GAGCCTCCGGATGAGACGAAATYGTAATCAAYCTGAGCATGAGGACAGAA
Long Flanking Sequence:
AACCACATCAACCAACCACCAAGACAGTTCTACAAGACCTCACAGTTTTTGCATGTTGGAAGCAACCAACTCTAAACAAGTTATTTTGCCTACCTCTGCTTCCACTAATCATGGTTTTCCAGATGTGGTCCAGCGGTGTAGGACAAGGCGAGCTGAGCTGCGTGCCATCGATGGTTTAAAACCTGACATGCCGCCATCTGCCAGCCTGTTACCTCTTCGTCTAGAAGAACCGCCAATCCGACGGACTTTGAAAAGCAGGAGCAAACCAAGGCCTGTTAGCATGACTGTTCTTGAGCTTTATAAAGAGCGTAGTGGATCTCGGGATGAGCTTGCAAGCCATACTGGCACCGGTAGTTTGCCTCGTCCAGGATTCCGGTGGAAATGGTTTGGTCGACAGGCAACTGGAAAAGAAATGGGGGTGACACAAATTTCAGCAAAGCTGAAGGAATCTAACAAAGAAGAAGCACCCAAAAAAATGTTCGGATCGCTGAGAAGGAGTT[T/A]GAGCCTCCGGATGAGACGAAATCGTAATCAACCTGAGCATGAGGACAGAACTGAGCTGAGACGCACTGCAAGTATTGGAGAAAAATCTATGCAAAGCACTCGCCCATTCTCGTACCTTACTGGCAGGACGTTAGCACCAGCATGTGAGCAAGATGAGGACCAAGGGGCCACACAATACATACAGTACCAAACACAGGGCAAAGTAGCAGTCTTGGAGGTTCCTCTTCGACCTGCCAAATTAACCAAGCCCACTAAACAAATGCAGCCAGAGACTAGTTTTTGGCAGCTAATTGCTAGTCGTTTTAAGAGGAAGGAGCCGTTGTCCAGCAACAAATCTGAGCTGAGCACTGGAAGCCAAGCAGTTGGCAGCCATCCCCCTGTGAGAAATAAAAAGCCAGATTCTGTTGCTATAGAGACTCTAGCTGGCATTGGTTTCCGCAAAGGTCAAGGTAAGTCGTGTAAAATGCATAATTTTATTCCACATCCCAGTCTGACGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37933
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Essential Splice Site 541 1047 3 13
Genomic Location (Zv9):
Chromosome 24 (position 35660107)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34429787
GRCz11 24 34315962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCACCGGTATCTGACAGGAACATATGTCCAGGAGGAGTCGCCTGAGGG[T/C]GAGTGAACAGCGGGACGCTCAATACAGAGTGTTTGTCAGGCCGGTCACCC
Long Flanking Sequence:
TACAGAAACCAACCATTTCAACCAACCTGTTAGAAAAATGCTAATGTGGCAGTGGATAAGTCAAGAAAATGAATGTGTTTTTTTTTTCTTCCCTTAATTGCATTTAAACTTTTAGGAGGCCTTTAAATAATATGACAAACCTTTAAAATCCATAATAGGGGCACTTTAATGAAACTGAATATTGTCTGTCAGGCCAATTAGATTAGTTATACAAACAACAGATTGCTTTCTTTATTTTTCACACTCTCCGAGAAGTAAATTGGTTCAGTTTTATTAGTTATTCACCATCCTGAAATCAGCCTCATCGATTATGTTCCAGACAGTCATTAGTTTTCTGTTCTGCTCGTCTCGTCTCTGCTATTATGCACCCGAACACTCTGACTCATGTCTGTTTTTTTTTTCTGCACGCAGGGCATCGTGGGAAACCTGTCCAGTGGGAAGTCGGCATTAGTTCACCGGTATCTGACAGGAACATATGTCCAGGAGGAGTCGCCTGAGGG[T/C]GAGTGAACAGCGGGACGCTCAATACAGAGTGTTTGTCAGGCCGGTCACCCAACAAGACCCCCTGCCGTGTTTTGTCACGTATGCTCATCTGCGCGCCGCATTCATTTGTTTATTTTTAGATGAACAGATTATTGTGGCTGCTAGGTTGAAAATTCAAGCTTCAGAAGTGAGGTTAGAACATTGTAAGTTAGAAAATCAGATCATTTATTAACTTATGGGGTAAATTTAAGATATAGAAGCAGTAAACATTGATTTTCATGTTGGTTATAGGTCGGGTGCACTGATCTCGATACTTGGTCCAGATATCGGTTCGATACTGCTTATTTTGCTGGATCCGCTATCGGCTATTTATACACTCTAAAAAATATTGTTTAGACCATACAAAAAAAAATAATAATAATTACGCAACAGTTTGCATCAATCTATTTAGGTTACAACAACATCTAACAAAATGAAGTTCAGACAACAAACTTTGTTATGTTAGCCAAAAGGCCTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37932
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 750 1047 8 13
Genomic Location (Zv9):
Chromosome 24 (position 35626324)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34396004
GRCz11 24 34282179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCGTCGCCGCCTCCAACACTCCTACGCCCATCCGCAAGCAGTCCAAG[C/T]GACGCTCCAACATCTTCACAGTAAGTATGAGGCAGCTAATGCAGAGCACC
Long Flanking Sequence:
TCTATCTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTATCTATCTATCTATCATCTATCTACCTATCTATCTATCATCATCTGTCTATCTGTGTCTGTCATTTGGTCTTTTACATTGTTCAATCTAACTCTATATCTGTCAATCTGTCTGTTGTTTTTTTTCCTTTTTCTTTTCTATCTACCCCTCTCTCCCTCCCTATTCCTTCTCTTGTTTCTTTCAGGCTGCTAACGGAGGAGGCGCGTTCAGCGATTACTCCTCCTCGGTTCCCTCCACCCCCAGCATAAGCCAGAGGGAGATGCGCATCGAGACCGTCGCCGCCTCCAACACTCCTACGCCCATCCGCAAGCAGTCCAAG[C/T]GACGCTCCAACATCTTCACAGTAAGTATGAGGCAGCTAATGCAGAGCACCACGCACTCCCACTACTGAGAGTGCTGGACTTCCCCTGACTGCAGATCTCCCAGCAGCTGCGTTCAGACAAGACAGCCAGCTAGAGAGATGCTGTTTCTAGGTCTGCAGTGAGTGGATCTGCCCTTAGGTACCCTCTCATCATCCCTTCCCCTCAAACCCAGGGCAGCGGAGGGCAAAGCCAGAGAGTGTAATGCCATCTCTGACCACTAGAGGGAGGTATGGAGCTAAGTTTAACTGAATCCCTACCACAGAAGCGCATGATCACGTGCTTTTTTATATAGCTACGTATTTCAGTAAGAGAAGAGAGGCAAGTAAGCTTAGCAAAAAAAATAAGTAAATAAATAACGGAAAGACGCTTCGATTTATGCTAATGTCTTTTATTTGTTTTATTTGCCTCACATCCTTTATACACTGTAAAATGTAAAGCTTTACACAAAAGGGAATTAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30125
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 803 1047 10 13
Genomic Location (Zv9):
Chromosome 24 (position 35605711)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34375391
GRCz11 24 34261566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTAAAAAGAAGCGGGAAGTCTCTCAATAAGGAGTGGAAGAAGAAATA[T/A]GTGACTTTGTGTGACAACGGTCTGCTCACGTACCACCCCAGTTTACACGT
Long Flanking Sequence:
TGTTTTTAACAGAAGAAAGAATCTTGATTAAATTAGAGTAAATTTTCATCGTGGCTGAACTATCCGTTAATTAAAAGAATTGCGAGTGAGTTTACTTTGTTGTTTAATAAAGTTGTGAAAATATGAAGCTCTGATCGGTCCAAGAACAACACGACGAACTTACAAATCACTGAAGAAAATCAGTGGTGAAAGTAAAGAGAGAGAGAAAAAGCTTAGTGCTTCATCTTAACAATGTGAAAATTGACTGTGAAAATCCACTCAGTGTGTAAATGGGCTGTGAATGAGTGTGTGTTGAGTGATGGGGAAACTTTAGCTTTACGTTGTGATCATCAGCTGATAGTTCTATACTTAAAGCTCAATTATTAAAACCCCTGTCCTGCTTGTAATTGTGAATGCATCCTGATCTGAAATCTCCTCTTTACTGATTGCTTCTGTCTTAAACAGGGGATTTTGTTAAAAAGAAGCGGGAAGTCTCTCAATAAGGAGTGGAAGAAGAAATA[T/A]GTGACTTTGTGTGACAACGGTCTGCTCACGTACCACCCCAGTTTACACGTGAGTATCTTTATCTATGGCTACTGAGTTCACAAATCTGATTCATTTTTGCTGAATCGATTCATTTGGATGATTTGGCTCAGTGAACTGCTTCTGTGATTCACTGATTTGTAATTGTATTGTATTGGTGAATAATTAGTGTTTCATGTCTGCGTTGTGATCCTTAAGTCTGAATGAAATCCCATTTTAAAGTGTTTTTTGGTAGCGCACTTTTTTAGTCTTAATGTGAACCATAAAATCCCTTAATTCACTTTTTAAAACAGTTTAATAATCTTTAATCAAAATCTGACCATTTAATTCTGCTCTGGAACAACAGTCTTCCTCTGATTGTTTCTTTCTTTCTCAAATATTTCTCAAGCGATATTTAATGCAGTATTTTATATAATATTTTTCTTCCGGGGAAAGTCTTATTTCTTTTAATTTAGCTGAAATAAAAACAGTTAAAAATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128690 Nonsense 842 1047 11 13
Genomic Location (Zv9):
Chromosome 24 (position 35599610)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34369290
GRCz11 24 34255465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATGGTAAAGAGATCGATCTGCTGCGGACGACGGTGAAGGTGCCAGGG[A/T]AGAGACCGCCTAGAGCAGTGGCTACAGTCGCCCCTACAGCCAGTCCAAAA
Long Flanking Sequence:
AGTAAAGATCAGATTTGATAAACGAGACTGACAGAACCATAAGGATTTTTACAGTCTGTTGAGGTTTGTGAAAAACTCACACCTAAGCAATGCATGTGACTTCATTCTCCATATGAGAGGCGTCTTTATCTATTACTTTAAGGCGTCTTTAAGTACCGTCCTGCGGTATGATTGACATGGAATGCGCAATGTGTTTTTGCCGCATGTGTGCAGAATTTGCCTCATTTGTGTCCTCTACATGCAGGACGGTGGCTCTCCAGGAACAGGGTTGGCCACCCCTGGTATACAGAATAGATTCAGAAGAAACAAAGCCACTCAGCCTTTTCAAACTTTTTTTCCCCTCAAACAAAGAACAAGAAACAACTTCGTGCCAAATCGGAGTTTAGTTTTTGCTGGTTTCCCAGGCTCTAATGCTTCGAAATATCACTTTTCAGGACTACATGCAGAATGTTCATGGTAAAGAGATCGATCTGCTGCGGACGACGGTGAAGGTGCCAGGG[A/T]AGAGACCGCCTAGAGCAGTGGCTACAGTCGCCCCTACAGCCAGTCCAAAAACCAACGGCCTGACCAAAGACCGCAGCACTTTACAACTCGGCATCGGAGCCACAAGTGAGTCATCAGCTCATTCATTCAGCTGGATTATAAGTGAAAATACTCTGTGATTTTATTTTTGAAGATATTTATATGCACAACTTATATCGGTGCTAACGTTTACGATTCATATTATCAGCATACCATTTACTAATAGTTTAAGCTCAGTAAACTACTAATTAGTTGCTTATTAATCGTTAGTAATGTAGTAACTGGGTTTAGGTATTGGGTAGTATTAGGAATGTAAAATAAGATAATTTTTTTTAAGTGCTAATAAACAGTTGATGACTGAATATTAACCGTAGACAGTAGTAAATGGTCTGAGTTGTTACTTAAGCTAAAGTGTTACAGTCAGTTTTTTTTTTCATGGGAAATTACATATTTTTCTCTCTCTTATGGACTTGTAATGGATA
Associated Phenotype:
Not determined