Busch Lab

ZMP

MAP4K3 (1 of 2)

Ensembl ID:
ENSDARG00000087742
Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Human Orthologue:
MAP4K3
Human Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Mouse Orthologue:
Map4k3
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154405]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35117 Essential Splice Site Available for shipment Available now
sa11669 Nonsense Available for shipment Available now
sa38850 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35117
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Essential Splice Site 104 903 4 34
Genomic Location (Zv9):
Chromosome 11 (position 31325024)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30202386
GRCz11 11 30449570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCCATGGAATACTGTGGAGGAGGTTCGCTGCAAGACATATATCACGG[T/A]AAGTTACACCGCACAAAGGTAAACAATCAACTGCAGCGCTAACTCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Nonsense 195 903 9 34
Genomic Location (Zv9):
Chromosome 11 (position 31315009)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30192371
GRCz11 11 30439555
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCCAGAAGTTGCTGCTGTGGAGAGGAAAGGAGGCTACAATCATYTGWG[T/A]GATATCTGGGCTGTCGGCAKCACTGCCATTGAACTAGCTGAACTGCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38850
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Essential Splice Site 668 903 26 34
Genomic Location (Zv9):
Chromosome 11 (position 31254907)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30132269
GRCz11 11 30379453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTGTTTCCATCCCGACACACAAACTGCCTGACAAAATGATTCCCAGG[T/C]GAATGTTTGCATCAGTCAAGATGTGGCCAGTTCTTAAAATGTTCATATTC
Associated Phenotype:
Not determined