Busch Lab

ZMP

NLRX1 (24 of 33)

Ensembl ID:
ENSDARG00000087736
Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42564 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122159 Nonsense 341 887 1 7
Genomic Location (Zv9):
Chromosome 15 (position 27705780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28424020
GRCz11 15 28356896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTCAGCCAGTATTACAGCCTGTTGGGTTTCTCTGTAGATCAGCAGAAG[C/T]AGTACTTTGAGAAGAACTGCAGATCTCCTGAGGCTGCTGCTGCAGTTTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4614
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122159 Nonsense 399 887 1 7
Genomic Location (Zv9):
Chromosome 15 (position 27705955)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28424195
GRCz11 15 28357071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGCATGACGGTGGCTCCTGCCTTTATCCTGATCCTGTAAATGCCAAGT[C/A]AGGAGAGCAAGAAGGCCTCGATAAAGATGACCTACAGATACCTTCTGAGA
Associated Phenotype:
Not determined