Busch Lab

ZMP

NADSYN1 (1 of 2)

Ensembl ID:
ENSDARG00000087722
Description:
NAD synthetase 1 [Source:HGNC Symbol;Acc:29832]
Human Orthologue:
NADSYN1
Human Description:
NAD synthetase 1 [Source:HGNC Symbol;Acc:29832]
Mouse Orthologue:
Nadsyn1
Mouse Description:
NAD synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:1926164]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa34224 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34224
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122965 Essential Splice Site 41 105 1 3
Genomic Location (Zv9):
Chromosome 7 (position 66321344)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54761690
GRCz11 7 55061030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTGCAAGCTCATTAGTTCGTGGAAAGACACCTTCTCTCCCTCACAGG[T/C]CAACATGCAGTAAATATTTCAGTACAACATTAGGATCCCATTTGCTTTTT
Associated Phenotype:
Not determined