Busch Lab

ZMP

KLHL29 (1 of 2)

Ensembl ID:
ENSDARG00000087688
Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Human Orthologue:
KLHL29
Human Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Mouse Orthologue:
Klhl29
Mouse Description:
kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39305 Nonsense Mutation detected in F1 DNA Not yet available
sa23797 Nonsense Available for shipment Available now
sa37145 Nonsense Available for shipment Available now
sa11650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39305
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 497 869 6 12
Genomic Location (Zv9):
Chromosome 20 (position 45144634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45040770
GRCz11 20 44944490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGACAGCCTGAACACCAAGGCAGAGGAGCTGGTTTATGAGACTGTCATC[A/T]AATGGATCAAGAAGGACCCCATCAACAGAGTACAGGTGAGAAGTGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23797
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 508 869 6 12
Genomic Location (Zv9):
Chromosome 20 (position 45144601)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45040737
GRCz11 20 44944457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATGAGACTGTCATCAAATGGATCAAGAAGGACCCCATCAACAGAGTA[C/T]AGGTGAGAAGTGCATTCGCCGCATGAAACATATGCCAGAGTAATGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37145
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 513 869 7 12
Genomic Location (Zv9):
Chromosome 20 (position 45110041)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45006177
GRCz11 20 44910673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGCTGAATATATATTCTCTCTCTTTTTCTCGCAGCACATATCAGAGT[T/A]GCTGGCTGTGGTCAGGCTTCCATTTATCCACCCCAGTTACCTGCTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11650
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 539 869 7 12
Genomic Location (Zv9):
Chromosome 20 (position 45109963)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45006099
GRCz11 20 44910595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACCCYAGTTACCTGCTGAACGTGGTGGACAATGAGGAGTTGATTAAAT[C/A]GTCGGAGGCTTGCCGAGACCTRGTGAATGAGGCCAAACGATACCACATGC
Associated Phenotype:
Not determined