Busch Lab

ZMP

C16orf11

Ensembl ID:
ENSDARG00000087663
Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Human Orthologue:
C16orf11
Human Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Mouse Orthologues:
A930017K11Rik, Nhlrc4
Mouse Descriptions:
NHL repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:3687200]
RIKEN cDNA A930017K11 gene Gene [Source:MGI Symbol;Acc:MGI:2442713]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa45839 Nonsense Mutation detected in F1 DNA Not yet available
sa16751 Nonsense Available for shipment Available now
sa11215 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30141
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 45 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39506653)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115742
GRCz11 24 38003639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGCAAACCCTACAACTACAAATGCTTCCAATGCCCCTTCACCTGCATG[G/T]AGAAATCACACCTGTACAACCACATGAAGTACAGCCTGTGCAAAAACTCC
Long Flanking Sequence:
TTTTTAATAAAAAATTAACATTGACTTTACTTGTAATATCATTCCAAATCACTAAAAATAAAACGTCTAAAAGTTAAAAGTTGTAATAATTTTATTTAATAACGATCTGAAAATTTTTAGATATATACTAACATGTCAAAATCAAAAATTTAATGCTTTTATTTTGTTTCCTCAACAGCTGAAATCTGATGGCTGCATTTCTACGTGATCCCACTCCTGATCAGACACAAGTGTACAATTCACAATCTCATCCTCACACACCTATTGCAAACCTGCCCTAAAAAGCACTCATAAACACACACACACACACTCACAAAGAGAAATCCATCTTTAAGAGAATCCTGGATTCCCCTGAATCAGACTGCACCATGTCCAAGGATAACTGCAAGCAAGTGGGCTGCAAACACAAAGAGCGCAAACCCAAAAAGCCGCACTACATCCCGCGCCCATGGGGCAAACCCTACAACTACAAATGCTTCCAATGCCCCTTCACCTGCATG[G/T]AGAAATCACACCTGTACAACCACATGAAGTACAGCCTGTGCAAAAACTCCCTGTCGCTGCTAATCGAGTCCGACTGGCCCTATAAAAAAGACCAGCTCCGGCTCCAGCAGGTAGCCGTCCGCTCTCGAAGCCCAGCGAAAGCTCACTCTGAGCAGGCAACAACCCCAGATGAGCCCTCGCACTCATCAGCCAATCTGGAGGAGGAAGAAACTGAAAAAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCATCGGAAACGTGTTCAAGAAGAGCGAAGCCATCAAAACAAGAAGCCGAATTGGTGATGGCGGACATGTTTTCTTTGGAAGAGCAACTTTTGCGAGCCCGCTCAGTGGAGGTGGAATCAAAACTGAGACACTACAGGCTGTCAAAAACATGTCTGTCAGGCCCAGCCGCGCTGCTTTCAGAACAATGGCGCATACTTAGCAATCAAACATCCAATGTGAAGCCAAAACCAGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45839
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 117 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39506437)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115526
GRCz11 24 38003423
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGAGCCCTCGCACTCATCAGCCAATCTGGAGGAGGAAGAAACTGAA[A/T]AAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCA
Long Flanking Sequence:
CTGATCAGACACAAGTGTACAATTCACAATCTCATCCTCACACACCTATTGCAAACCTGCCCTAAAAAGCACTCATAAACACACACACACACACTCACAAAGAGAAATCCATCTTTAAGAGAATCCTGGATTCCCCTGAATCAGACTGCACCATGTCCAAGGATAACTGCAAGCAAGTGGGCTGCAAACACAAAGAGCGCAAACCCAAAAAGCCGCACTACATCCCGCGCCCATGGGGCAAACCCTACAACTACAAATGCTTCCAATGCCCCTTCACCTGCATGGAGAAATCACACCTGTACAACCACATGAAGTACAGCCTGTGCAAAAACTCCCTGTCGCTGCTAATCGAGTCCGACTGGCCCTATAAAAAAGACCAGCTCCGGCTCCAGCAGGTAGCCGTCCGCTCTCGAAGCCCAGCGAAAGCTCACTCTGAGCAGGCAACAACCCCAGATGAGCCCTCGCACTCATCAGCCAATCTGGAGGAGGAAGAAACTGAA[A/T]AAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCATCGGAAACGTGTTCAAGAAGAGCGAAGCCATCAAAACAAGAAGCCGAATTGGTGATGGCGGACATGTTTTCTTTGGAAGAGCAACTTTTGCGAGCCCGCTCAGTGGAGGTGGAATCAAAACTGAGACACTACAGGCTGTCAAAAACATGTCTGTCAGGCCCAGCCGCGCTGCTTTCAGAACAATGGCGCATACTTAGCAATCAAACATCCAATGTGAAGCCAAAACCAGACGTGGCGGCTCCGTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATCGAATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTTGGTGTGGGTTATCCTTTGGCTCCAGGACTTCTGTCATATTTAAATCCAACACTAAGCAATGCAAACCCGTCAAACGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCACAGAGACACTCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16751
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 228 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39506104)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115193
GRCz11 24 38003090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCGGCTCCRTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATC[G/T]AATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTYGGTGTGGGTTAT
Long Flanking Sequence:
CCCTGTCGCTGCTAATCGAGTCCGACTGGCCCTATAAAAAAGACCAGCTCCGGCTCCAGCAGGTAGCCGTCCGCTCTCGAAGCCCAGCGAAAGCTCACTCTGAGCAGGCAACAACCCCAGATGAGCCCTCGCACTCATCAGCCAATCTGGAGGAGGAAGAAACTGAAAAAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCATCGGAAACGTGTTCAAGAAGAGCGAAGCCATCAAAACAAGAAGCCGAATTGGTGATGGCGGACATGTTTTCTTTGGAAGAGCAACTTTTGCGAGCCCGCTCAGTGGAGGTGGAATCAAAACTGAGACACTACAGGCTGTCAAAAACATGTCTGTCAGGCCCAGCCGCGCTGCTTTCAGAACAATGGCGCATACTTAGCAATCAAACATCCAATGTGAAGCCAAAACCAGACGTGGCGGCTCCGTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATC[G/T]AATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTTGGTGTGGGTTATCCTTTGGCTCCAGGACTTCTGTCATATTTAAATCCAACACTAAGCAATGCAAACCCGTCAAACGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCACAGAGACACTCGGAGCGTTCTCTACTCCCTCCGCATCTGTATTATCCGTTCTTGTGCGAACACACATTTGGAGCGACTCCTTCTTCATCAGCATCTGAAGCCAGTAAACTCATTAAAGCTCCATCTGTGGGTCTTCAGCCGCCTTCATATCCTCCAAAACTGAGCCTGTGGAAGGTGCCGGCGCTGCGGCCCTCGTCCAGCCAGAGCTCCCCGGCTGCGGTCTGGACGTCCCCCACACACTCGTCCCCAGAGCCGGGCCTCGGGGCACTGCAGGAGCGGGTGAGGGACAGGAAAAGCAGCTGGCAGCAGGAAACGTCGAGTCTGAAGAGGACAGCGATGGCGGGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11215
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 282 634 1 2
Genomic Location (Zv9):
Chromosome 24 (position 39505941)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38115030
GRCz11 24 38002927
KASP Assay ID:
2261-9027.1 (used for ordering genotyping assays)
KASP Sequence:
CGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCRCAGAGACACT[C/A]GGAGCGTTCTCTACTCCCTCCGCATCTGTATTATCCGTTCTTGTGCGAAC
Long Flanking Sequence:
TGAAAAAAGAGATGAAAAAGATGAAGACATCCAAGAAGCAAATGCAGAAAACCCATCGGAAACGTGTTCAAGAAGAGCGAAGCCATCAAAACAAGAAGCCGAATTGGTGATGGCGGACATGTTTTCTTTGGAAGAGCAACTTTTGCGAGCCCGCTCAGTGGAGGTGGAATCAAAACTGAGACACTACAGGCTGTCAAAAACATGTCTGTCAGGCCCAGCCGCGCTGCTTTCAGAACAATGGCGCATACTTAGCAATCAAACATCCAATGTGAAGCCAAAACCAGACGTGGCGGCTCCGTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATCGAATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTTGGTGTGGGTTATCCTTTGGCTCCAGGACTTCTGTCATATTTAAATCCAACACTAAGCAATGCAAACCCGTCAAACGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCACAGAGACACT[C/A]GGAGCGTTCTCTACTCCCTCCGCATCTGTATTATCCGTTCTTGTGCGAACACACATTTGGAGCGACTCCTTCTTCATCAGCATCTGAAGCCAGTAAACTCATTAAAGCTCCATCTGTGGGTCTTCAGCCGCCTTCATATCCTCCAAAACTGAGCCTGTGGAAGGTGCCGGCGCTGCGGCCCTCGTCCAGCCAGAGCTCCCCGGCTGCGGTCTGGACGTCCCCCACACACTCGTCCCCAGAGCCGGGCCTCGGGGCACTGCAGGAGCGGGTGAGGGACAGGAAAAGCAGCTGGCAGCAGGAAACGTCGAGTCTGAAGAGGACAGCGATGGCGGGGTTCGACACCCATGGTGCACCGGTGGAAAAGAAACCAGCGCTGGAGATCGGCCTCGAGACTTTGAAAAACACTCAGAAACCTGCATCCATCGCTGCCTTGATGTCCAGCAGGATGCCCATACACAACAGGTGAGACACTGTTATCCTTTAAAATTGACATATTACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30140
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 589 634 2 2
Genomic Location (Zv9):
Chromosome 24 (position 39502358)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38111447
GRCz11 24 37999344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCTCTGGTGAAGACGGAGGTGTTGACAGGCAGCGCTGAAGCTCTGTG[G/A]CACAGCAGGACCACAAAGTGTGAAGCGGATTCAAGTGTCCTTCTGTGCTC
Long Flanking Sequence:
ACTTCACTGTATATCTAATAGAACTTTGTGTGTTCCCGCAGCGCCGGCTCGTCCCCGCTGCATCTGTCTGAGCAGCTGGAGGCCAGACAGAGAGGAATGGAGAGAGAATCGGCGCTCCTGCAGGACTTCAGCGCATTATTACAGGAGTACCAGCTCACCGAGCAGCGCGCCGCGTCCCTACCGGAGCAGTGCCATCTGTGGGCACACCTGGGCAAGATCCGCACGGAGCTCTCGCATATTCAACAGGCACTAGAGCGGACAGCTCGGTCCAACGAAGGACCTCTGGATCTGTCAGTCAAAAAGGATCATCCACTAATCATCAATGCAATTCCTGGAGAAACTAAAGACGAAGACTGCTCTGAAACTGAAGATGAAGATGATGACGATGATGATGATGAAGATGACGGTAAAGACAGACGCAAGTGTTCTCTGGATGCGCTGATGAAGCTGAATCCTCTGGTGAAGACGGAGGTGTTGACAGGCAGCGCTGAAGCTCTGTG[G/A]CACAGCAGGACCACAAAGTGTGAAGCGGATTCAAGTGTCCTTCTGTGCTCCAAAACGCCCAACAGACCCCCGTCCATCCAGCATCTGGACACACTCTGTCCCAGCAGCCCGCTCACAACCACTGACACACTGGTGTAGAGGAGATCACACACACACACACCCTGGACGAAACTAACAGGCAAATGATCAGATGTACAGCTGAAGTCTACATTTCCCAAATGATGTTGAACAGATTCAGGAATTTTTCACAGTATTTCCAATAATATTCTTTCTTCTTATTTGTTTAATTTAGGCTAAAATAAAGGCAATTTTTTATTTTTTCAAACCCATTTTAAGGTCAATATTATTAGCCCCCTTAAGCAATATTTGTTTTGGTTGTCTACAGAACAATATCTAGGCAAATAATATGTACTTTCATCATGGCAAGGATATTAGATATGAGTTAATAAAAATATTATGTTTAGAAATGTGTTGAAAAAATCATATTATTATATACTATA
Associated Phenotype:
Not determined