Busch Lab

ZMP

ENSDARG00000087660

Ensembl ID:
ENSDARG00000087660

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13257 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13257
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122277 Essential Splice Site 72 96 2 3
Genomic Location (Zv9):
Chromosome 5 (position 69227766)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65561031
GRCz11 5 66240136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGGCCCGCAYGGTTCTGAAAGAAGGATTAAACAAGCATATGGGAAAGG[T/G]ATTATTCTAGCRTGTCGCTTCAGATGCATCGTCACTTCTCYTTTGCACRT
Associated Phenotype:
Not determined