Busch Lab

ZMP

LOC569427

Ensembl ID:
ENSDARG00000087625
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23196 Essential Splice Site Available for shipment Available now
sa36545 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23196
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Essential Splice Site 19 466 2 5
Genomic Location (Zv9):
Chromosome 17 (position 53123353)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52508920
GRCz11 17 52595220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGACATTATGAGTAGAAAGGTTGATGTTTTCCCTTGTGTCCTGCA[G/A]GCAGTGAGCCTCTGGGCTGAAGGCAGTGCCTCCAGTGGAGAGTGCATCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28942
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Essential Splice Site 70 466 3 5
Genomic Location (Zv9):
Chromosome 17 (position 53122819)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52508386
GRCz11 17 52594686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGGACATAACAATTGACAGATGGACACAACATTTACTGGTTCTTCTGC[A/T]GGTTGAGGTGTACGAGGTCAAGCTGCAGGTCTACATTGCAAAGATGAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4731
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Nonsense 159 466 4 5
Genomic Location (Zv9):
Chromosome 17 (position 53122036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52507603
GRCz11 17 52593903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTATGATTTCTGTGCTGACTCAACTGGAGATCACCTAYGACAAGAACT[T/A]GGTTCTCGTGACCCGCCGAGAATATTTAATTCTTCAGCAGAAACTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Nonsense 363 466 5 5
Genomic Location (Zv9):
Chromosome 17 (position 53118501)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52504068
GRCz11 17 52590368
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGGCGGACTCGAAGGGTAAACTAGTCCTAGGGAAGATCAATGAACAGT[C/A]ATTCGCAGTCGAGACGGTCTTTCAGACCAGTGTTTATAAACCCTCTGTCG
Associated Phenotype:
Not determined