Busch Lab

ZMP

MAPT (2 of 2)

Ensembl ID:
ENSDARG00000087616
Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Human Orthologue:
MAPT
Human Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Mouse Orthologue:
Mapt
Mouse Description:
microtubule-associated protein tau Gene [Source:MGI Symbol;Acc:MGI:97180]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33151 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40055 Nonsense Mutation detected in F1 DNA Not yet available
sa30832 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8114
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Essential Splice Site 502 752 5 11
Genomic Location (Zv9):
Chromosome 3 (position 22390151)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22046542
GRCz11 3 22177090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTTTCTTACAGCCAAGGCTGGAGCAGGGGCAACTCCTGAAAAAAAGG[T/A]ATAGTAATTATGACTGGTGGGTTCCTAAGAAATATAGTTACATGTCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Essential Splice Site 618 752 8 11
Genomic Location (Zv9):
Chromosome 3 (position 22385729)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22042120
GRCz11 3 22172668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGATCGGCTCCACTGAGAACCTCAAACACCAACCTGGAGGCGGGAAG[G/A]TAGTTATGTCATGCATGTCAGAAAATTGGGACACAATTAATCTAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40055
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Nonsense 633 752 9 11
ENSDART00000130546 Nonsense 633 752 9 11
Genomic Location (Zv9):
Chromosome 3 (position 22381674)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22038065
GRCz11 3 22168613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCAGATTCAGATTGTGCACAAAAAGATCGACCTAAGCAACGTCCAGT[C/A]AAAGTGCGGCTCCAAGGCCAACATTCATCACAAACCGGGTGAGATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Nonsense 633 752 9 11
ENSDART00000130546 Nonsense 633 752 9 11
Genomic Location (Zv9):
Chromosome 3 (position 22381674)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22038065
GRCz11 3 22168613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCAGATTCAGATTGTGCACAAAAAGATCGACCTAAGCAACGTCCAGT[C/A]AAAGTGCGGCTCCAAGGCCAACATTCATCACAAACCGGGTGAGATTTCAA
Associated Phenotype:
Not determined