Busch Lab

ZMP

ENSDARG00000087600

Ensembl ID:
ENSDARG00000087600
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45123 Nonsense Mutation detected in F1 DNA Not yet available
sa6023 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5173
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125202 Essential Splice Site 69 541 2 5
Genomic Location (Zv9):
Chromosome 2 (position 57551080)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56700457
GRCz11 2 56824302
KASP Assay ID:
554-3473.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGGCTCATCCTGAGAACCTGGACAACCTCCTCCTCAGATACTACAAGG[T/C]ACAACATGCAAATCCCAGCAGATACTACTGTCACAGTTTNTTCACTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45123
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125202 Nonsense 106 541 4 5
Genomic Location (Zv9):
Chromosome 2 (position 57543634)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56693011
GRCz11 2 56816856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTTTTTTTTCTCAGGAAGGGAAAGTGTAAGCAGATCGAGGAGGGT[C/T]AGGAGTGTTTTCTGGGAATGCGTCTCCGCCAGTATCACATGCTGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6023
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125202 Nonsense 300 541 5 5
Genomic Location (Zv9):
Chromosome 2 (position 57538717)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56688094
GRCz11 2 56811939
KASP Assay ID:
554-3702.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAAACGTTCGATCTTGAGGACCTGATTTCCCAGGAGCAGCAGAGACAC[C/T]GACAGGTGGTGTTAAACTCAAACATGCGCATGCCGTCATCGCATTCGTCT
Associated Phenotype:
Not determined