Busch Lab

ZMP

SPTBN4 (1 of 3)

Ensembl ID:
ENSDARG00000087594
Description:
spectrin, beta, non-erythrocytic 4 [Source:HGNC Symbol;Acc:14896]
Human Orthologue:
SPTBN4
Human Description:
spectrin, beta, non-erythrocytic 4 [Source:HGNC Symbol;Acc:14896]
Mouse Orthologue:
Spnb4
Mouse Description:
spectrin beta 4 Gene [Source:MGI Symbol;Acc:MGI:1890574]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39219 Nonsense Mutation detected in F1 DNA Not yet available
sa39218 Nonsense Mutation detected in F1 DNA Not yet available
sa23377 Nonsense Available for shipment Available now
sa32220 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7867
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 78 1177 2 17
Genomic Location (Zv9):
Chromosome 18 (position 44479131)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46064625
GRCz11 18 46062643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATGTGTTTTCAAACATGTTTTCTTTGTGTTTGTCTGCAGTTGTGGATA[C/T]AAGAGCATATTCCAGTGGCCACTTCTCAGGAACTCGGGACAAGTTTACAA
Long Flanking Sequence:
AAACGTGCTAGCGCAACGCAGAGATACCAGACTCTCAAGTAGAGCTACGGATATTCCTGTTGGTTGCTGGGCCGCCGAGCCCCCTATTTTGGATAAAGGTGGAAGAAGGGGGAGGAGGGGGGATTCTTCAAGACGAAGATAGTTGTAAGTGGAAAAGGAGGAGATATATATAGGAACTAGGGATCCTTGATTGGAGGATCGTGGTTAGCTAATATGAGCCAGCTGGTTTAATCATGATCACGTACTCCTCTCGAAATTAGTTTAATAAATGAAACTTCACTTGAAGACATGTTATTGTGTTTGGACAAATTGTAAGGATGTGCCATACCAAATATTTTCTTTCCAATCCGACACAAAGTATTTCAAGACTAGTATCTCTGATATCGATACCAATACTTCAATCAAATATTTATTAGTTTTTTTTATTATAAATCTAAAAAATATATTTCAAAATGTGTTTTCAAACATGTTTTCTTTGTGTTTGTCTGCAGTTGTGGATA[C/T]AAGAGCATATTCCAGTGGCCACTTCTCAGGAACTCGGGACAAGTTTACAAGCTGTACAGCAACTCATGAAGAAGAATCAAGTAAGCCCAGTTACCATGAACTAAACTGAACTGTTGTCTGGTTTCTAAATGTCGTTTTAATTCAGAAGGTTTCATGCTCTCTCGTGAGAGCACCTCACTACATATAAAACACTGAGGCTTTAAGTCTTTTTTTGTCATCAATATATGTAAATCCATACTTTACATATTCAAGGTCGTACCTGTGCTTCGTCATATTTGTTGCTATAATTAAATGAAATTTCACATGTCAAACGGTAGGCTTGTCGCGCACGCATTTCAAAATAAAAGTCAAAACTAGTTTTTTAACACACTCCACGACCCACTGAAAATGTTCCACCAGTTGAGAAATACTGGTCTAGATAGTATACAGCTGCGTTTACGCCATCAATTTAGCATAGTTATTGTAATATTGTAAAACAATAATTAATAATTTTACAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39219
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 108 1177 3 17
Genomic Location (Zv9):
Chromosome 18 (position 44477909)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46063403
GRCz11 18 46061421
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGATGTGGCGTAACTCTGTGCTGTTCATCTGCTCTCAGACTCTTCAG[C/T]GAGAGCTTCATGGCCACCGCTCGCGGGTGGAGGACGTCCTGGAGCGAGCA
Long Flanking Sequence:
TGTCAAAGCATTTCAAACAAGCTGTATCAGCCTGGATTCGAACCCACTATCCCCGCACGGTAGTCAGAAACCTTAATCGCTCCACTAAATCACAGGTTCAAGCCTACAAAGTGGGGTTTAATACCTCAATTAGCTCAACTGTTCTTTGCTGCAGCTGTTCCAGTGCAATACATAAAAAATCACCACTAGGTGTCATTGTAGAGTGGGGTTTCGAAATGTTTCGAAGATTCGACACATTTGCTGCGACTGTTTCAGGGTTTCATGAAGCCTCGCTTTGCCCACCACTACTTTCCTGCAGATTTCTGTTGCACATCATACAATTATCAAGTGCTGTTCAGGTCCTAATTAATTGGCTCAGGTGTGTTTGAACAGGGTTGGAGCTTAACTATGCAGAAAGGTAGAAATCCAGCAACAGGGTTGAGCACCCCTGTTTTAGACAATGTTTGTGAAATGAGATGTGGCGTAACTCTGTGCTGTTCATCTGCTCTCAGACTCTTCAG[C/T]GAGAGCTTCATGGCCACCGCTCGCGGGTGGAGGACGTCCTGGAGCGAGCAGGTCTCATCTCCTCCATCCGCAGTCCAGAGGCCGACAGTATCCGGGCCGGCATGGAGCAGCTCCATCAGCTGTGGGAGGCACTGTGGGCAGAGACGGAGCGCCGGCAGCTCACACTGGACGCCATGTACCAGGCACAGCAGTACTACTTTGATGTGGCAGAGGTGGAGGCCTGGCTGAGCGAACAGGAGCTGCACATGATGAATGAGGAGACCGGGAAGGTAGGATGACTGTGGGGATTAGGGTTGTTCTGCTACTGTTTCTAGTATCGGAAATACCAATAATGCAAACATTCTGGTATTGGGGAGTATTTGAAACCATAAACCAATCCGATGCCATCTTCTTAAATTAGACATGTGCACAGCCTTTTTATAATTCAGTTCATCTTTATATCTATAGTGCTTTTACAATGTAGATAGTGTTAACGCAGCTTAAAGGGCACCTATGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39218
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 209 1177 4 17
Genomic Location (Zv9):
Chromosome 18 (position 44475990)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46061484
GRCz11 18 46059502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTCTGTCTGTTCAGGATGAGGCCAGTACTCTGCAGCTGCTGAAGAAA[C/T]AGCTGGTGCTCGAGCAGACCATCGAGGACTATGCAGAAACCATCGGCCTG
Long Flanking Sequence:
GTGCGGTCCCCCCACCCACCAATATTGATTGAGCACCCCTAGTATTCAGCTTAAAGTGACATTTAAAAGCTTAACTGGGTTAAATAGGCAAGTCATTGTTTGTTCTGTATACATTAAAAACAAATATTGTTTAAGGGGGCTAATAATATTGACTGTAAAATGGTTTTAAAAAAGTTAAAAACTGCTTTTATTCTAGCCAAAATAAAACAAGACTTTCTCCTAAAGAAAAAAAAATATTTATAGGAAATACTATGAAAAATTCCTGAATCTGTTAAACCTCATTTTTGAAATATTAAAAAAAGAAACTAAATTTGACTTACACTGTATATACAGTAGTGCCACTGGTCCAGCAGACAGAAAAATGGACACTAGTGTAGACGTTATTTTCAGCCGAGGTCACCTGGCAGCATTATTGCAGATGCTATAGCTGATGACACAGAAGGATGAATGTATCTCTGTCTGTTCAGGATGAGGCCAGTACTCTGCAGCTGCTGAAGAAA[C/T]AGCTGGTGCTCGAGCAGACCATCGAGGACTATGCAGAAACCATCGGCCTGCTGTCTCAGCAGTGCAGACAGTTGCTTGAGCTCGGACATCCAGACTGGTGAATGATCAGCAGTCGCCTTACACTCAAACATCCACTGACTGCATCTCTACATACTATCATGAAATAATAATGAACAATACTTGTGCAGCATTCGTTAATCATAGTTGAACATTTACAGGAGTAACCGATGTCAGAGATGTGCTCCTGTGAATGAAATCCAGGTTTATGTTCGTGTTTCAGTGAGCAGATCAGCAAGCGTCAGTCTCAGATCGACAGGCTGTACGTGTCTCTGAAGGACCTGGTGGAGGAGAGGAAGTCTCGTCTGGAGCAGCAGTATTGGCTCTATCAGCTGAACAGAGAAGTGGATGAGCTGGAGCAGTGGATCGCGGAGAGAGAGGTCATCGCCAGCTCCACTGAACTCGGACAGGACTTTGAGCACGTCACGGTCAGTTCATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23377
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Nonsense 448 1177 8 17
Genomic Location (Zv9):
Chromosome 18 (position 44468054)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46053548
GRCz11 18 46051566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACATGTTTTCCTCAGGTAAGACAGCTACAGGAGAGCGCAGCACAGCTC[C/T]GAACGGTTTACGCCGGTGAGAAAGCAGAGGCAATTGCCATGCAGGAACAC
Long Flanking Sequence:
CCATATTAATAGCATGTCAGTTTGGCTTGCTCACCGCTGGACAAGCACTAGTGGCTTTTAACACATGAGAGAGGGTTCTTTTGCTGTGCTCGTGTTTAAGGAGGCGTGGCTCTAGACGGCAGGGGAGGGACTGTGATTCAGAGATTTATGCTAAGCTGTTAGCATTGTGGAAGATCACCTACTGCACCTTTAAGCCTTTACATGTCACTTTAAGCTGAATTCTAGTATCTTGAAAAATATCTAGTCAAATATTATTTACTGTCATCATGGTAAAGATAAAATAGATGAGTTATTAGAAATGAGTTATTAAAACTATTATGATTAGAAATGGGTTGAAAAAATCTCTCCGCTAAACAGAAAGTGGGTAAATAAATAGGTAAAGGGGGCTAATAATTCAAGGGGTTAATAACTCTGACTTCAACTTAATCAGTTTGTGGATAGATCTCTCTCACACATGTTTTCCTCAGGTAAGACAGCTACAGGAGAGCGCAGCACAGCTC[C/T]GAACGGTTTACGCCGGTGAGAAAGCAGAGGCAATTGCCATGCAGGAACACGAGGTGATGCAGGCGTGGAAAGAGCTGCTGATATCTTGTGAGGACTGCCGAATGCAGATAACCACAGCCACAGACAAGCTACGTTTCTTCGGGATGGTGCGTGACCAGCTGATGTGGATGGAAAGCATCATCTGCCAGATAGGAACTGGGGAGAAGCCAAGGTAGGACACACATGCTGGGACACTCGCTCTCCACTTATAGAAACTCATTAAGGTGCTTTAACATTATAATGCATGAAGATTTGCATCAGAGCAGATGGAGATTAGCCACTGTGGCCGCTGGAGTGTATTATAGATATCATACCACGTGCACAGATAAATGATAAGGTGGTAAGTGCATAACCTGCAAGAGTATTTATTCTTCCGATCAAGCATAATAGTTCTGTGTTTATTAAGAGCACTGTGTAGGAAAACAATAGATCTGTTACAAAACTTTTTGAGCTGCTACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32220
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078561 Essential Splice Site 943 1177 13 17
Genomic Location (Zv9):
Chromosome 18 (position 44453713)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46039207
GRCz11 18 46037225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACGTTAGCAGAGATTGTGGAGCAGCTTCAGGAAAGAGAAGCAGCACAG[G/A]TGTGTGGACAGTCTGTTTGTTTCTCTTGTTCAAACTACATTAGGTCACAT
Long Flanking Sequence:
TATCATAATTATAATAATAATATTAATAATAATAATATAAGTAAAAATCATAATATAATAAATATAAATATAATAATATAAATATAAAGTATAATTGAGCCTTAACAGAGCTTAACTCCACACACAGTAGAGAAGGTAATTAAAAACATTGACCTGGAAAAATTTGATCGATTATAGGTCCTGAATGTCGATTTCGATTTCTTTTCGATTAATCAGCCAGCCCTGGCGTCGGCCATCAGTATAAGAGAGCACACTGATTGGTCATTCAGCAAGGAATCATTGCGAGAACAAAAACGACAACTCAAGTAAACAATACAAGTCAAGAAGGACAGAAGCCAGCTGTTATTTCTCTGCATTTCTCAAATATTTGCAGACGATATAGATTATTAGATTAAGAGACCTATTGCAAGGTTTCAGACTTCCCCTTTTATGTTGGCAGGGAGAAAAGATCCACGTTAGCAGAGATTGTGGAGCAGCTTCAGGAAAGAGAAGCAGCACAG[G/A]TGTGTGGACAGTCTGTTTGTTTCTCTTGTTCAAACTACATTAGGTCACATGCTCATTATTACCTTATATTTGAAACTCAGGCTAGAGGAGAGATTCCACGACTCCCCAATGGATTGCCGGAAAAGACTTCTCGACCGGACCGGCCTCGGGCTCGGGATAGACCCAAACCGAGAAGACGACCAAGACCCAAGGAACCAACAGCTGGCGAAACACGACGCTCGAGGTCTGCTCCAGCTCAGAGCAGTCCACAAGTACCCCTGCCACCCACCCACACGGCCCAGCACGAAGGGTTCCTCTTCCGAAAAATTGACATCGAGGGCCAAAAGAAGAGTTCAAACAGGTGGGATTTTGTGGTCTAACCATTAAGGGTACATGGCATGGAATTAGCATGGAAATGGCTAAACTAAATATGCCAATCAGTATGATTGGTTATTCAAAGCTATGCTAATTTTGTTATTAGCATTGTGTATTGATGCTAGAGCACTGACATTTTTAATACA
Associated Phenotype:
Not determined