Busch Lab

ZMP

ENSDARG00000087576

Ensembl ID:
ENSDARG00000087576

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40324 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128689 Nonsense 412 488 2 2
Genomic Location (Zv9):
Chromosome 4 (position 41345489)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 41158787
GRCz11 4 41700656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAGAAACCATTTACGTGCACTCAGTGTGGGAAGAGTTTCCGC[C/T]AAGCGTCATCACTTAATATACACATGAGGACCCACACTGGAGAGAAACCA
Associated Phenotype:
Not determined